Incidental Mutation 'R8186:C130073F10Rik'
ID 634854
Institutional Source Beutler Lab
Gene Symbol C130073F10Rik
Ensembl Gene ENSMUSG00000046133
Gene Name RIKEN cDNA C130073F10 gene
Synonyms
MMRRC Submission 067609-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.064) question?
Stock # R8186 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 101747217-101750986 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 101748031 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 48 (R48*)
Ref Sequence ENSEMBL: ENSMUSP00000059092 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051043]
AlphaFold Q8C4L8
Predicted Effect probably null
Transcript: ENSMUST00000051043
AA Change: R48*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Add2 G A 6: 86,085,002 (GRCm39) V543M probably benign Het
Agl A G 3: 116,552,557 (GRCm39) I459T possibly damaging Het
Arhgap45 G A 10: 79,863,706 (GRCm39) A819T probably damaging Het
Atg16l2 C T 7: 100,945,714 (GRCm39) probably null Het
Bltp2 A G 11: 78,177,457 (GRCm39) T1921A probably damaging Het
Cdc25b C T 2: 131,031,050 (GRCm39) T125M probably benign Het
Cdc42bpg T A 19: 6,356,895 (GRCm39) F50L probably damaging Het
Chd9 T A 8: 91,725,233 (GRCm39) D1187E unknown Het
Col4a2 T C 8: 11,475,542 (GRCm39) probably null Het
Cped1 T C 6: 22,123,587 (GRCm39) S447P probably benign Het
Ddx19a T A 8: 111,710,274 (GRCm39) M109L probably benign Het
Def8 C A 8: 124,188,215 (GRCm39) Y431* probably null Het
Gata4 A G 14: 63,438,962 (GRCm39) S373P probably benign Het
Gm9837 A T 11: 53,361,136 (GRCm39) L26* probably null Het
Hspa1b A T 17: 35,176,557 (GRCm39) V476E probably damaging Het
Htr5b G A 1: 121,456,108 (GRCm39) probably benign Het
Hydin T C 8: 111,336,277 (GRCm39) V5018A probably benign Het
Ighv1-85 A G 12: 115,963,923 (GRCm39) S26P probably benign Het
Kics2 T A 10: 121,581,247 (GRCm39) F83I possibly damaging Het
Lrrc2 A G 9: 110,789,910 (GRCm39) K56E possibly damaging Het
Macf1 A T 4: 123,266,219 (GRCm39) I6793N probably damaging Het
Macf1 A C 4: 123,275,923 (GRCm39) V6215G possibly damaging Het
Nbeal1 G C 1: 60,276,310 (GRCm39) V684L probably benign Het
Nfxl1 A G 5: 72,716,355 (GRCm39) probably null Het
Odad4 A G 11: 100,454,505 (GRCm39) D430G probably benign Het
Oprk1 A T 1: 5,672,540 (GRCm39) M226L probably benign Het
Or1e1 T C 11: 73,245,247 (GRCm39) S223P possibly damaging Het
Phf2 A G 13: 48,961,227 (GRCm39) L821P unknown Het
Rdh7 C A 10: 127,723,284 (GRCm39) probably null Het
Rpl11 A G 4: 135,778,968 (GRCm39) V74A possibly damaging Het
Safb2 G A 17: 56,873,051 (GRCm39) R790C possibly damaging Het
Sgpp2 T C 1: 78,393,609 (GRCm39) F204S probably benign Het
Sgsm3 A C 15: 80,893,643 (GRCm39) I426L possibly damaging Het
Speer1b A G 5: 11,823,926 (GRCm39) D158G probably damaging Het
Styxl2 A G 1: 165,927,648 (GRCm39) S655P probably damaging Het
Tbccd1 A G 16: 22,637,189 (GRCm39) L545P probably damaging Het
Toporsl T A 4: 52,610,489 (GRCm39) F127L probably damaging Het
Ttn T G 2: 76,749,256 (GRCm39) Q3931P probably damaging Het
Tuba1c C A 15: 98,935,396 (GRCm39) L286I probably benign Het
Usp48 A G 4: 137,348,507 (GRCm39) R528G possibly damaging Het
Utrn T C 10: 12,573,867 (GRCm39) T1068A probably benign Het
Vmn2r103 A T 17: 20,032,205 (GRCm39) T660S probably damaging Het
Vmn2r105 G T 17: 20,444,880 (GRCm39) Y537* probably null Het
Vmn2r88 A T 14: 51,656,157 (GRCm39) I744F Het
Wnt9b T C 11: 103,621,601 (GRCm39) E352G probably damaging Het
Zfp78 A G 7: 6,376,228 (GRCm39) N46D probably damaging Het
Other mutations in C130073F10Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02805:C130073F10Rik APN 4 101,748,171 (GRCm39) start codon destroyed probably null 1.00
IGL02869:C130073F10Rik APN 4 101,747,590 (GRCm39) nonsense probably null
R0621:C130073F10Rik UTSW 4 101,747,992 (GRCm39) missense probably damaging 1.00
R1368:C130073F10Rik UTSW 4 101,747,953 (GRCm39) missense possibly damaging 0.78
R1471:C130073F10Rik UTSW 4 101,747,535 (GRCm39) missense probably benign 0.01
R4732:C130073F10Rik UTSW 4 101,747,907 (GRCm39) missense probably benign 0.03
R4733:C130073F10Rik UTSW 4 101,747,907 (GRCm39) missense probably benign 0.03
R5372:C130073F10Rik UTSW 4 101,747,684 (GRCm39) missense probably damaging 1.00
R5777:C130073F10Rik UTSW 4 101,747,946 (GRCm39) missense possibly damaging 0.49
R6510:C130073F10Rik UTSW 4 101,747,482 (GRCm39) missense probably benign 0.01
R6888:C130073F10Rik UTSW 4 101,747,453 (GRCm39) missense probably benign 0.12
R7229:C130073F10Rik UTSW 4 101,747,439 (GRCm39) missense probably benign 0.00
R8353:C130073F10Rik UTSW 4 101,747,881 (GRCm39) splice site probably null
R8857:C130073F10Rik UTSW 4 101,747,555 (GRCm39) missense possibly damaging 0.52
R9559:C130073F10Rik UTSW 4 101,747,946 (GRCm39) missense possibly damaging 0.49
R9590:C130073F10Rik UTSW 4 101,747,618 (GRCm39) missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- ACAGTCTTGCCTACCACAAG -3'
(R):5'- AACCCTTATCCTGAGCTGCC -3'

Sequencing Primer
(F):5'- GAACTCAGACTCACTCACCTAGG -3'
(R):5'- AGCCATCCTAAGCTTTGTTCTGAGAG -3'
Posted On 2020-07-13