Incidental Mutation 'V1662:Olfr524'
ID 63486
Institutional Source Beutler Lab
Gene Symbol Olfr524
Ensembl Gene ENSMUSG00000050366
Gene Name olfactory receptor 524
Synonyms GA_x6K02T2PBJ9-42354580-42353624, MOR103-14P
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock # V1662 () of strain 633
Quality Score 118
Status Not validated
Chromosome 7
Chromosomal Location 140198499-140205964 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 140201958 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Asparagine at position 271 (D271N)
Ref Sequence ENSEMBL: ENSMUSP00000150970 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051943] [ENSMUST00000215815]
AlphaFold Q7TRU0
Predicted Effect possibly damaging
Transcript: ENSMUST00000051943
AA Change: D271N

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000053565
Gene: ENSMUSG00000050366
AA Change: D271N

DomainStartEndE-ValueType
Pfam:7tm_4 32 309 7.5e-56 PFAM
Pfam:7tm_1 42 292 6.4e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000215815
AA Change: D271N

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb G C 5: 114,238,708 G1951R probably damaging Het
Adamts12 T A 15: 11,071,808 L146Q probably benign Het
Adgra1 T C 7: 139,852,579 I111T probably damaging Het
Amph G A 13: 19,139,370 V601M probably benign Het
Arfgef1 T C 1: 10,173,253 K1024E probably damaging Het
Arhgef2 G A 3: 88,633,329 R154Q probably damaging Het
Bank1 T A 3: 136,054,418 D782V probably damaging Het
Bhlha9 G T 11: 76,673,036 R163L probably benign Het
Cacna1h T C 17: 25,377,309 N1913D possibly damaging Het
Cd7 T C 11: 121,037,126 I184V probably benign Het
Cdk2ap1 T A 5: 124,348,676 I68F possibly damaging Het
Cfap44 C A 16: 44,449,138 Y1168* probably null Het
D6Ertd527e T C 6: 87,111,892 S346P unknown Het
Daam2 A G 17: 49,464,601 L839P possibly damaging Het
Fam198a A G 9: 121,965,025 R82G probably damaging Het
Gm7030 A G 17: 36,128,931 Y104H probably benign Het
Golgb1 A G 16: 36,898,542 H270R probably benign Het
Itgav C T 2: 83,783,854 R519W possibly damaging Het
Lrp1b A T 2: 41,122,932 I2001K probably damaging Het
Lrrc40 T A 3: 158,052,789 I277K probably damaging Het
Olfr1025-ps1 C A 2: 85,918,594 T223K probably benign Het
Olfr1350 A T 7: 6,570,819 Y276F probably damaging Het
Olfr1373 T C 11: 52,145,177 M118V probably damaging Het
Pyroxd1 G A 6: 142,358,443 G307S probably damaging Het
Rp1 T A 1: 4,349,560 Y443F probably damaging Het
Rpusd4 C A 9: 35,272,761 S237R probably benign Het
Sdk2 A C 11: 113,834,908 W1172G probably damaging Het
Utrn A G 10: 12,421,640 Y675H probably damaging Het
Vmn1r193 A G 13: 22,219,075 I249T possibly damaging Het
Other mutations in Olfr524
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01991:Olfr524 APN 7 140202432 missense probably damaging 1.00
IGL01999:Olfr524 APN 7 140202432 missense probably damaging 1.00
IGL02005:Olfr524 APN 7 140202432 missense probably damaging 1.00
IGL02030:Olfr524 APN 7 140202632 missense probably damaging 0.97
IGL02474:Olfr524 APN 7 140202587 missense probably damaging 1.00
H8441:Olfr524 UTSW 7 140201958 missense possibly damaging 0.81
R0426:Olfr524 UTSW 7 140202116 missense possibly damaging 0.81
R0704:Olfr524 UTSW 7 140202635 missense probably benign 0.00
R0891:Olfr524 UTSW 7 140202459 missense probably damaging 1.00
R1624:Olfr524 UTSW 7 140201951 missense probably damaging 0.96
R1865:Olfr524 UTSW 7 140202372 missense probably damaging 1.00
R1938:Olfr524 UTSW 7 140202231 missense probably benign 0.30
R2105:Olfr524 UTSW 7 140202743 missense probably benign 0.02
R3009:Olfr524 UTSW 7 140202756 missense probably benign
R3546:Olfr524 UTSW 7 140202101 missense probably damaging 1.00
R4849:Olfr524 UTSW 7 140202427 nonsense probably null
R5009:Olfr524 UTSW 7 140201838 missense probably benign
R5105:Olfr524 UTSW 7 140202549 missense probably damaging 1.00
R5413:Olfr524 UTSW 7 140202722 missense possibly damaging 0.94
R5422:Olfr524 UTSW 7 140202392 missense probably damaging 1.00
R7314:Olfr524 UTSW 7 140202413 missense probably damaging 0.99
R7338:Olfr524 UTSW 7 140202533 missense probably benign 0.01
R7921:Olfr524 UTSW 7 140202299 missense probably damaging 1.00
R8438:Olfr524 UTSW 7 140202257 missense probably damaging 1.00
R9261:Olfr524 UTSW 7 140202650 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- CCAATCTGTTCACCCTGATGGACTG -3'
(R):5'- AGAGCTTGTAGACTTCCTCCTGGC -3'

Sequencing Primer
(F):5'- ACCCTGATGGACTGGTGAG -3'
(R):5'- TCATCTTGTTGGGGCCAC -3'
Posted On 2013-07-30