Incidental Mutation 'V1662:Rpusd4'
ID63487
Institutional Source Beutler Lab
Gene Symbol Rpusd4
Ensembl Gene ENSMUSG00000032044
Gene NameRNA pseudouridylate synthase domain containing 4
Synonyms2410001E19Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.919) question?
Stock #V1662 () of strain 633
Quality Score200
Status Not validated
Chromosome9
Chromosomal Location35267865-35277731 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 35272761 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 237 (S237R)
Ref Sequence ENSEMBL: ENSMUSP00000034543 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034543] [ENSMUST00000059057] [ENSMUST00000063782] [ENSMUST00000121564] [ENSMUST00000125087]
Predicted Effect probably benign
Transcript: ENSMUST00000034543
AA Change: S237R

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000034543
Gene: ENSMUSG00000032044
AA Change: S237R

DomainStartEndE-ValueType
Pfam:PseudoU_synth_2 105 277 5.5e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000059057
SMART Domains Protein: ENSMUSP00000058377
Gene: ENSMUSG00000050471

DomainStartEndE-ValueType
low complexity region 71 86 N/A INTRINSIC
Pfam:SIR2_2 157 301 1.9e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000063782
SMART Domains Protein: ENSMUSP00000066281
Gene: ENSMUSG00000050471

DomainStartEndE-ValueType
Pfam:SIR2_2 75 225 7.7e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121564
SMART Domains Protein: ENSMUSP00000113537
Gene: ENSMUSG00000050471

DomainStartEndE-ValueType
low complexity region 71 86 N/A INTRINSIC
Pfam:SIR2_2 157 301 2.7e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125087
SMART Domains Protein: ENSMUSP00000119747
Gene: ENSMUSG00000050471

DomainStartEndE-ValueType
low complexity region 71 86 N/A INTRINSIC
Pfam:SIR2_2 157 268 3.1e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125124
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130552
Predicted Effect probably benign
Transcript: ENSMUST00000144582
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146571
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147256
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb G C 5: 114,238,708 G1951R probably damaging Het
Adamts12 T A 15: 11,071,808 L146Q probably benign Het
Adgra1 T C 7: 139,852,579 I111T probably damaging Het
Amph G A 13: 19,139,370 V601M probably benign Het
Arfgef1 T C 1: 10,173,253 K1024E probably damaging Het
Arhgef2 G A 3: 88,633,329 R154Q probably damaging Het
Bank1 T A 3: 136,054,418 D782V probably damaging Het
Bhlha9 G T 11: 76,673,036 R163L probably benign Het
Cacna1h T C 17: 25,377,309 N1913D possibly damaging Het
Cd7 T C 11: 121,037,126 I184V probably benign Het
Cdk2ap1 T A 5: 124,348,676 I68F possibly damaging Het
Cfap44 C A 16: 44,449,138 Y1168* probably null Het
D6Ertd527e T C 6: 87,111,892 S346P unknown Het
Daam2 A G 17: 49,464,601 L839P possibly damaging Het
Fam198a A G 9: 121,965,025 R82G probably damaging Het
Gm7030 A G 17: 36,128,931 Y104H probably benign Het
Golgb1 A G 16: 36,898,542 H270R probably benign Het
Itgav C T 2: 83,783,854 R519W possibly damaging Het
Lrp1b A T 2: 41,122,932 I2001K probably damaging Het
Lrrc40 T A 3: 158,052,789 I277K probably damaging Het
Olfr1025-ps1 C A 2: 85,918,594 T223K probably benign Het
Olfr1350 A T 7: 6,570,819 Y276F probably damaging Het
Olfr1373 T C 11: 52,145,177 M118V probably damaging Het
Olfr524 C T 7: 140,201,958 D271N possibly damaging Het
Pyroxd1 G A 6: 142,358,443 G307S probably damaging Het
Rp1 T A 1: 4,349,560 Y443F probably damaging Het
Sdk2 A C 11: 113,834,908 W1172G probably damaging Het
Utrn A G 10: 12,421,640 Y675H probably damaging Het
Vmn1r193 A G 13: 22,219,075 I249T possibly damaging Het
Other mutations in Rpusd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00597:Rpusd4 APN 9 35268442 missense probably benign 0.34
IGL00722:Rpusd4 APN 9 35268418 missense possibly damaging 0.66
IGL01657:Rpusd4 APN 9 35273461 unclassified probably benign
IGL01780:Rpusd4 APN 9 35268424 missense probably damaging 0.98
IGL03290:Rpusd4 APN 9 35267977 missense probably benign
R0607:Rpusd4 UTSW 9 35267993 missense possibly damaging 0.93
R1081:Rpusd4 UTSW 9 35275088 missense probably benign 0.04
R1441:Rpusd4 UTSW 9 35272769 missense probably damaging 0.97
R2029:Rpusd4 UTSW 9 35268014 missense probably benign 0.00
R3929:Rpusd4 UTSW 9 35272580 missense probably benign 0.29
R4107:Rpusd4 UTSW 9 35275128 missense probably damaging 1.00
R4840:Rpusd4 UTSW 9 35268535 missense probably damaging 1.00
R5429:Rpusd4 UTSW 9 35272602 missense probably benign 0.01
R5801:Rpusd4 UTSW 9 35270073 missense possibly damaging 0.83
R5988:Rpusd4 UTSW 9 35272520 splice site probably null
R6318:Rpusd4 UTSW 9 35268038 missense probably damaging 1.00
R7819:Rpusd4 UTSW 9 35267932 missense probably benign
R7995:Rpusd4 UTSW 9 35272721 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCAAACAGCAGTCTGTGTGTCACC -3'
(R):5'- TCCCTCCTGGGCTAAGTCAATTATACC -3'

Sequencing Primer
(F):5'- ATCACGGTGCGTGTTCC -3'
(R):5'- TGGGCTAAGTCAATTATACCCACAC -3'
Posted On2013-07-30