Incidental Mutation 'R8186:Olfr20'
ID634876
Institutional Source Beutler Lab
Gene Symbol Olfr20
Ensembl Gene ENSMUSG00000062128
Gene Nameolfactory receptor 20
SynonymsOlfr21, MOR135-11, MTPCR55, MTPCR06, GA_x6K02T2P1NL-3514066-3515010
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R8186 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location73350783-73355951 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 73354421 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 223 (S223P)
Ref Sequence ENSEMBL: ENSMUSP00000114110 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108465] [ENSMUST00000117445] [ENSMUST00000120137]
Predicted Effect possibly damaging
Transcript: ENSMUST00000108465
AA Change: S223P

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000104105
Gene: ENSMUSG00000062128
AA Change: S223P

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 7.9e-60 PFAM
Pfam:7TM_GPCR_Srsx 35 305 7.8e-8 PFAM
Pfam:7tm_1 41 290 1e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117445
Predicted Effect possibly damaging
Transcript: ENSMUST00000120137
AA Change: S223P

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000114110
Gene: ENSMUSG00000062128
AA Change: S223P

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.3e-61 PFAM
Pfam:7TM_GPCR_Srsx 35 305 1.5e-6 PFAM
Pfam:7tm_1 41 290 2.2e-26 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik A G 11: 78,286,631 T1921A probably damaging Het
Add2 G A 6: 86,108,020 V543M probably benign Het
Agl A G 3: 116,758,908 I459T possibly damaging Het
Atg16l2 C T 7: 101,296,507 probably null Het
BC048403 T A 10: 121,745,342 F83I possibly damaging Het
C130073F10Rik G A 4: 101,890,834 R48* probably null Het
Cdc25b C T 2: 131,189,130 T125M probably benign Het
Cdc42bpg T A 19: 6,306,865 F50L probably damaging Het
Chd9 T A 8: 90,998,605 D1187E unknown Het
Col4a2 T C 8: 11,425,542 probably null Het
Cped1 T C 6: 22,123,588 S447P probably benign Het
Ddx19a T A 8: 110,983,642 M109L probably benign Het
Def8 C A 8: 123,461,476 Y431* probably null Het
Dusp27 A G 1: 166,100,079 S655P probably damaging Het
Gata4 A G 14: 63,201,513 S373P probably benign Het
Gm8926 A G 5: 11,773,959 D158G probably damaging Het
Gm9837 A T 11: 53,470,309 L26* probably null Het
Hmha1 G A 10: 80,027,872 A819T probably damaging Het
Hspa1b A T 17: 34,957,581 V476E probably damaging Het
Htr5b G A 1: 121,528,379 probably benign Het
Hydin T C 8: 110,609,645 V5018A probably benign Het
Ighv1-85 A G 12: 116,000,303 S26P probably benign Het
Lrrc2 A G 9: 110,960,842 K56E possibly damaging Het
Macf1 A T 4: 123,372,426 I6793N probably damaging Het
Macf1 A C 4: 123,382,130 V6215G possibly damaging Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nfxl1 A G 5: 72,559,012 probably null Het
Oprk1 A T 1: 5,602,317 M226L probably benign Het
Phf2 A G 13: 48,807,751 L821P unknown Het
Rdh7 C A 10: 127,887,415 probably null Het
Rpl11 A G 4: 136,051,657 V74A possibly damaging Het
Safb2 G A 17: 56,566,051 R790C possibly damaging Het
Sgpp2 T C 1: 78,416,972 F204S probably benign Het
Sgsm3 A C 15: 81,009,442 I426L possibly damaging Het
Tbccd1 A G 16: 22,818,439 L545P probably damaging Het
Toporsl T A 4: 52,610,489 F127L probably damaging Het
Ttc25 A G 11: 100,563,679 D430G probably benign Het
Ttn T G 2: 76,918,912 Q3931P probably damaging Het
Tuba1c C A 15: 99,037,515 L286I probably benign Het
Usp48 A G 4: 137,621,196 R528G possibly damaging Het
Utrn T C 10: 12,698,123 T1068A probably benign Het
Vmn2r103 A T 17: 19,811,943 T660S probably damaging Het
Vmn2r105 G T 17: 20,224,618 Y537* probably null Het
Vmn2r88 A T 14: 51,418,700 I744F Het
Wnt9b T C 11: 103,730,775 E352G probably damaging Het
Zfp78 A G 7: 6,373,229 N46D probably damaging Het
Other mutations in Olfr20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00589:Olfr20 APN 11 73354043 missense probably damaging 1.00
IGL02163:Olfr20 APN 11 73354494 missense probably damaging 1.00
R0598:Olfr20 UTSW 11 73353903 missense probably benign
R1348:Olfr20 UTSW 11 73353856 missense probably benign 0.02
R2006:Olfr20 UTSW 11 73354692 missense probably benign
R2085:Olfr20 UTSW 11 73354421 missense possibly damaging 0.95
R2263:Olfr20 UTSW 11 73354305 missense possibly damaging 0.89
R3421:Olfr20 UTSW 11 73354634 missense probably damaging 1.00
R3422:Olfr20 UTSW 11 73354634 missense probably damaging 1.00
R4229:Olfr20 UTSW 11 73354232 missense probably damaging 1.00
R4749:Olfr20 UTSW 11 73354496 missense probably damaging 1.00
R5410:Olfr20 UTSW 11 73353806 missense probably benign 0.11
R6035:Olfr20 UTSW 11 73353756 start codon destroyed probably null 1.00
R6035:Olfr20 UTSW 11 73353756 start codon destroyed probably null 1.00
R6499:Olfr20 UTSW 11 73354185 missense probably damaging 1.00
R7840:Olfr20 UTSW 11 73353759 missense probably benign
R7959:Olfr20 UTSW 11 73353918 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGCTGACCACTTTCCATGC -3'
(R):5'- GAGTCACCACTGTGTACATCATG -3'

Sequencing Primer
(F):5'- ATACCCTGCTCATGGCCAGATTG -3'
(R):5'- ACTGTGTACATCATGGCCATG -3'
Posted On2020-07-13