Incidental Mutation 'V1662:Fam198a'
ID63488
Institutional Source Beutler Lab
Gene Symbol Fam198a
Ensembl Gene ENSMUSG00000038233
Gene Namefamily with sequence similarity 198, member A
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #V1662 () of strain 633
Quality Score199
Status Not validated
Chromosome9
Chromosomal Location121950988-121980209 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 121965025 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 82 (R82G)
Ref Sequence ENSEMBL: ENSMUSP00000150724 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043011] [ENSMUST00000213773] [ENSMUST00000214536] [ENSMUST00000215990]
Predicted Effect probably benign
Transcript: ENSMUST00000043011
AA Change: R82G

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000040221
Gene: ENSMUSG00000038233
AA Change: R82G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 183 194 N/A INTRINSIC
Pfam:FAM198 220 544 1.3e-150 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213773
AA Change: R82G

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably damaging
Transcript: ENSMUST00000214536
AA Change: R82G

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214808
Predicted Effect probably benign
Transcript: ENSMUST00000215990
AA Change: R82G

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb G C 5: 114,238,708 G1951R probably damaging Het
Adamts12 T A 15: 11,071,808 L146Q probably benign Het
Adgra1 T C 7: 139,852,579 I111T probably damaging Het
Amph G A 13: 19,139,370 V601M probably benign Het
Arfgef1 T C 1: 10,173,253 K1024E probably damaging Het
Arhgef2 G A 3: 88,633,329 R154Q probably damaging Het
Bank1 T A 3: 136,054,418 D782V probably damaging Het
Bhlha9 G T 11: 76,673,036 R163L probably benign Het
Cacna1h T C 17: 25,377,309 N1913D possibly damaging Het
Cd7 T C 11: 121,037,126 I184V probably benign Het
Cdk2ap1 T A 5: 124,348,676 I68F possibly damaging Het
Cfap44 C A 16: 44,449,138 Y1168* probably null Het
D6Ertd527e T C 6: 87,111,892 S346P unknown Het
Daam2 A G 17: 49,464,601 L839P possibly damaging Het
Gm7030 A G 17: 36,128,931 Y104H probably benign Het
Golgb1 A G 16: 36,898,542 H270R probably benign Het
Itgav C T 2: 83,783,854 R519W possibly damaging Het
Lrp1b A T 2: 41,122,932 I2001K probably damaging Het
Lrrc40 T A 3: 158,052,789 I277K probably damaging Het
Olfr1025-ps1 C A 2: 85,918,594 T223K probably benign Het
Olfr1350 A T 7: 6,570,819 Y276F probably damaging Het
Olfr1373 T C 11: 52,145,177 M118V probably damaging Het
Olfr524 C T 7: 140,201,958 D271N possibly damaging Het
Pyroxd1 G A 6: 142,358,443 G307S probably damaging Het
Rp1 T A 1: 4,349,560 Y443F probably damaging Het
Rpusd4 C A 9: 35,272,761 S237R probably benign Het
Sdk2 A C 11: 113,834,908 W1172G probably damaging Het
Utrn A G 10: 12,421,640 Y675H probably damaging Het
Vmn1r193 A G 13: 22,219,075 I249T possibly damaging Het
Other mutations in Fam198a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00985:Fam198a APN 9 121978335 missense probably damaging 1.00
IGL01722:Fam198a APN 9 121965083 missense possibly damaging 0.92
IGL02733:Fam198a APN 9 121965028 missense probably benign 0.00
R0514:Fam198a UTSW 9 121978352 missense possibly damaging 0.62
R1344:Fam198a UTSW 9 121978386 missense probably damaging 0.98
R1868:Fam198a UTSW 9 121965427 missense possibly damaging 0.71
R2279:Fam198a UTSW 9 121965602 missense probably benign 0.00
R3237:Fam198a UTSW 9 121964869 missense possibly damaging 0.83
R3753:Fam198a UTSW 9 121965833 missense probably damaging 1.00
R4967:Fam198a UTSW 9 121965718 missense probably damaging 1.00
R5192:Fam198a UTSW 9 121965661 missense probably benign
R5196:Fam198a UTSW 9 121965661 missense probably benign
R5560:Fam198a UTSW 9 121978223 missense possibly damaging 0.94
R5588:Fam198a UTSW 9 121965181 nonsense probably null
R5689:Fam198a UTSW 9 121965688 missense probably damaging 1.00
R7017:Fam198a UTSW 9 121965986 critical splice donor site probably null
R7037:Fam198a UTSW 9 121965526 missense possibly damaging 0.61
R7041:Fam198a UTSW 9 121965401 missense probably damaging 0.98
R7045:Fam198a UTSW 9 121965641 missense probably damaging 1.00
R7170:Fam198a UTSW 9 121978235 missense probably damaging 1.00
R7505:Fam198a UTSW 9 121976417 missense probably benign 0.00
R7704:Fam198a UTSW 9 121951085 start gained probably benign
R7751:Fam198a UTSW 9 121964821 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCAGTGATGGCATTCTGCCTCTTG -3'
(R):5'- TGCCTGAAAAGATTCGTGGCTTCTC -3'

Sequencing Primer
(F):5'- AGGGCATCCAGCTTCCAC -3'
(R):5'- CTCTCTGTGAGTGGGACAAC -3'
Posted On2013-07-30