Incidental Mutation 'R8186:Vmn2r105'
ID634888
Institutional Source Beutler Lab
Gene Symbol Vmn2r105
Ensembl Gene ENSMUSG00000091670
Gene Namevomeronasal 2, receptor 105
SynonymsEG627743
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8186 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location20208230-20234872 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 20224618 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 537 (Y537*)
Ref Sequence ENSEMBL: ENSMUSP00000129762 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167382]
Predicted Effect probably null
Transcript: ENSMUST00000167382
AA Change: Y537*
SMART Domains Protein: ENSMUSP00000129762
Gene: ENSMUSG00000091670
AA Change: Y537*

DomainStartEndE-ValueType
Pfam:ANF_receptor 85 469 6.5e-42 PFAM
Pfam:NCD3G 512 565 3.2e-21 PFAM
Pfam:7tm_3 598 833 2.5e-51 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik A G 11: 78,286,631 T1921A probably damaging Het
Add2 G A 6: 86,108,020 V543M probably benign Het
Agl A G 3: 116,758,908 I459T possibly damaging Het
Atg16l2 C T 7: 101,296,507 probably null Het
BC048403 T A 10: 121,745,342 F83I possibly damaging Het
C130073F10Rik G A 4: 101,890,834 R48* probably null Het
Cdc25b C T 2: 131,189,130 T125M probably benign Het
Cdc42bpg T A 19: 6,306,865 F50L probably damaging Het
Chd9 T A 8: 90,998,605 D1187E unknown Het
Col4a2 T C 8: 11,425,542 probably null Het
Cped1 T C 6: 22,123,588 S447P probably benign Het
Ddx19a T A 8: 110,983,642 M109L probably benign Het
Def8 C A 8: 123,461,476 Y431* probably null Het
Dusp27 A G 1: 166,100,079 S655P probably damaging Het
Gata4 A G 14: 63,201,513 S373P probably benign Het
Gm8926 A G 5: 11,773,959 D158G probably damaging Het
Gm9837 A T 11: 53,470,309 L26* probably null Het
Hmha1 G A 10: 80,027,872 A819T probably damaging Het
Hspa1b A T 17: 34,957,581 V476E probably damaging Het
Htr5b G A 1: 121,528,379 probably benign Het
Hydin T C 8: 110,609,645 V5018A probably benign Het
Ighv1-85 A G 12: 116,000,303 S26P probably benign Het
Lrrc2 A G 9: 110,960,842 K56E possibly damaging Het
Macf1 A T 4: 123,372,426 I6793N probably damaging Het
Macf1 A C 4: 123,382,130 V6215G possibly damaging Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nfxl1 A G 5: 72,559,012 probably null Het
Olfr20 T C 11: 73,354,421 S223P possibly damaging Het
Oprk1 A T 1: 5,602,317 M226L probably benign Het
Phf2 A G 13: 48,807,751 L821P unknown Het
Rdh7 C A 10: 127,887,415 probably null Het
Rpl11 A G 4: 136,051,657 V74A possibly damaging Het
Safb2 G A 17: 56,566,051 R790C possibly damaging Het
Sgpp2 T C 1: 78,416,972 F204S probably benign Het
Sgsm3 A C 15: 81,009,442 I426L possibly damaging Het
Tbccd1 A G 16: 22,818,439 L545P probably damaging Het
Toporsl T A 4: 52,610,489 F127L probably damaging Het
Ttc25 A G 11: 100,563,679 D430G probably benign Het
Ttn T G 2: 76,918,912 Q3931P probably damaging Het
Tuba1c C A 15: 99,037,515 L286I probably benign Het
Usp48 A G 4: 137,621,196 R528G possibly damaging Het
Utrn T C 10: 12,698,123 T1068A probably benign Het
Vmn2r103 A T 17: 19,811,943 T660S probably damaging Het
Vmn2r88 A T 14: 51,418,700 I744F Het
Wnt9b T C 11: 103,730,775 E352G probably damaging Het
Zfp78 A G 7: 6,373,229 N46D probably damaging Het
Other mutations in Vmn2r105
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01433:Vmn2r105 APN 17 20228555 missense probably benign 0.01
IGL01909:Vmn2r105 APN 17 20224656 missense probably damaging 1.00
IGL01925:Vmn2r105 APN 17 20208711 missense possibly damaging 0.94
IGL02021:Vmn2r105 APN 17 20227895 missense possibly damaging 0.49
IGL02828:Vmn2r105 APN 17 20209083 missense possibly damaging 0.80
IGL02838:Vmn2r105 APN 17 20227585 missense probably damaging 1.00
IGL03343:Vmn2r105 APN 17 20226369 nonsense probably null
R0096:Vmn2r105 UTSW 17 20227479 missense possibly damaging 0.49
R0096:Vmn2r105 UTSW 17 20227479 missense possibly damaging 0.49
R0212:Vmn2r105 UTSW 17 20208565 missense possibly damaging 0.90
R0268:Vmn2r105 UTSW 17 20208676 missense probably benign 0.18
R0271:Vmn2r105 UTSW 17 20234703 missense probably damaging 0.96
R0613:Vmn2r105 UTSW 17 20208316 missense probably damaging 1.00
R0765:Vmn2r105 UTSW 17 20227711 missense probably benign 0.20
R0765:Vmn2r105 UTSW 17 20227857 missense probably damaging 0.98
R1162:Vmn2r105 UTSW 17 20227711 missense probably benign 0.20
R1263:Vmn2r105 UTSW 17 20208322 missense probably damaging 1.00
R1363:Vmn2r105 UTSW 17 20208670 missense probably benign 0.00
R1464:Vmn2r105 UTSW 17 20228742 splice site probably benign
R2029:Vmn2r105 UTSW 17 20224578 missense probably damaging 0.99
R2420:Vmn2r105 UTSW 17 20227835 missense probably benign 0.15
R2421:Vmn2r105 UTSW 17 20227835 missense probably benign 0.15
R2422:Vmn2r105 UTSW 17 20227835 missense probably benign 0.15
R2570:Vmn2r105 UTSW 17 20227323 missense probably damaging 1.00
R3847:Vmn2r105 UTSW 17 20208690 missense possibly damaging 0.85
R3848:Vmn2r105 UTSW 17 20208690 missense possibly damaging 0.85
R4030:Vmn2r105 UTSW 17 20208754 missense probably damaging 0.99
R4275:Vmn2r105 UTSW 17 20228640 missense probably damaging 1.00
R4551:Vmn2r105 UTSW 17 20226351 missense probably benign
R4801:Vmn2r105 UTSW 17 20227294 missense probably benign 0.00
R4802:Vmn2r105 UTSW 17 20227294 missense probably benign 0.00
R4816:Vmn2r105 UTSW 17 20208691 missense probably benign 0.27
R4929:Vmn2r105 UTSW 17 20228018 missense probably benign 0.44
R5022:Vmn2r105 UTSW 17 20208414 missense probably damaging 0.99
R5475:Vmn2r105 UTSW 17 20234782 missense probably benign
R5576:Vmn2r105 UTSW 17 20224574 critical splice donor site probably null
R5795:Vmn2r105 UTSW 17 20228736 missense probably benign 0.00
R5895:Vmn2r105 UTSW 17 20228667 missense probably benign 0.10
R6017:Vmn2r105 UTSW 17 20208627 missense probably damaging 0.97
R6210:Vmn2r105 UTSW 17 20228496 missense probably damaging 1.00
R6491:Vmn2r105 UTSW 17 20227730 nonsense probably null
R6542:Vmn2r105 UTSW 17 20228541 missense probably benign 0.03
R6729:Vmn2r105 UTSW 17 20208343 missense probably damaging 0.99
R7020:Vmn2r105 UTSW 17 20209074 missense probably damaging 1.00
R7033:Vmn2r105 UTSW 17 20208612 missense probably damaging 0.97
R7488:Vmn2r105 UTSW 17 20208783 missense probably damaging 1.00
R7491:Vmn2r105 UTSW 17 20228565 missense probably benign 0.02
R7555:Vmn2r105 UTSW 17 20227675 missense probably damaging 0.98
R7863:Vmn2r105 UTSW 17 20208675 missense probably benign 0.18
R8137:Vmn2r105 UTSW 17 20234704 missense probably benign 0.02
R8166:Vmn2r105 UTSW 17 20208642 missense probably benign 0.07
R8214:Vmn2r105 UTSW 17 20228513 missense probably benign 0.02
R8497:Vmn2r105 UTSW 17 20234872 start codon destroyed probably null 0.75
R8850:Vmn2r105 UTSW 17 20208610 missense probably damaging 1.00
R8880:Vmn2r105 UTSW 17 20208967 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGGCCATTTTAAAGGGGTAGAC -3'
(R):5'- CTAACACATTGATGATTCTCAGACC -3'

Sequencing Primer
(F):5'- GGTAGACATGGATTGTTGCATATAC -3'
(R):5'- AAATTTGCCTTATCATGGGTAAAAAC -3'
Posted On2020-07-13