Incidental Mutation 'R8186:Cdc42bpg'
ID634891
Institutional Source Beutler Lab
Gene Symbol Cdc42bpg
Ensembl Gene ENSMUSG00000024769
Gene NameCDC42 binding protein kinase gamma (DMPK-like)
SynonymsMRCKgamma
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.287) question?
Stock #R8186 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location6306456-6325652 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 6306865 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 50 (F50L)
Ref Sequence ENSEMBL: ENSMUSP00000025681 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025681]
Predicted Effect probably damaging
Transcript: ENSMUST00000025681
AA Change: F50L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000025681
Gene: ENSMUSG00000024769
AA Change: F50L

DomainStartEndE-ValueType
low complexity region 21 31 N/A INTRINSIC
S_TKc 71 337 1.63e-87 SMART
S_TK_X 338 400 7.85e-12 SMART
coiled coil region 444 551 N/A INTRINSIC
coiled coil region 630 675 N/A INTRINSIC
Pfam:DMPK_coil 743 801 4.6e-21 PFAM
low complexity region 861 873 N/A INTRINSIC
C1 878 926 1.78e-7 SMART
PH 947 1067 3.57e-10 SMART
Pfam:CNH 1096 1362 7.5e-56 PFAM
low complexity region 1401 1412 N/A INTRINSIC
low complexity region 1535 1551 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik A G 11: 78,286,631 T1921A probably damaging Het
Add2 G A 6: 86,108,020 V543M probably benign Het
Agl A G 3: 116,758,908 I459T possibly damaging Het
Atg16l2 C T 7: 101,296,507 probably null Het
BC048403 T A 10: 121,745,342 F83I possibly damaging Het
C130073F10Rik G A 4: 101,890,834 R48* probably null Het
Cdc25b C T 2: 131,189,130 T125M probably benign Het
Chd9 T A 8: 90,998,605 D1187E unknown Het
Col4a2 T C 8: 11,425,542 probably null Het
Cped1 T C 6: 22,123,588 S447P probably benign Het
Ddx19a T A 8: 110,983,642 M109L probably benign Het
Def8 C A 8: 123,461,476 Y431* probably null Het
Dusp27 A G 1: 166,100,079 S655P probably damaging Het
Gata4 A G 14: 63,201,513 S373P probably benign Het
Gm8926 A G 5: 11,773,959 D158G probably damaging Het
Gm9837 A T 11: 53,470,309 L26* probably null Het
Hmha1 G A 10: 80,027,872 A819T probably damaging Het
Hspa1b A T 17: 34,957,581 V476E probably damaging Het
Htr5b G A 1: 121,528,379 probably benign Het
Hydin T C 8: 110,609,645 V5018A probably benign Het
Ighv1-85 A G 12: 116,000,303 S26P probably benign Het
Lrrc2 A G 9: 110,960,842 K56E possibly damaging Het
Macf1 A T 4: 123,372,426 I6793N probably damaging Het
Macf1 A C 4: 123,382,130 V6215G possibly damaging Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nfxl1 A G 5: 72,559,012 probably null Het
Olfr20 T C 11: 73,354,421 S223P possibly damaging Het
Oprk1 A T 1: 5,602,317 M226L probably benign Het
Phf2 A G 13: 48,807,751 L821P unknown Het
Rdh7 C A 10: 127,887,415 probably null Het
Rpl11 A G 4: 136,051,657 V74A possibly damaging Het
Safb2 G A 17: 56,566,051 R790C possibly damaging Het
Sgpp2 T C 1: 78,416,972 F204S probably benign Het
Sgsm3 A C 15: 81,009,442 I426L possibly damaging Het
Tbccd1 A G 16: 22,818,439 L545P probably damaging Het
Toporsl T A 4: 52,610,489 F127L probably damaging Het
Ttc25 A G 11: 100,563,679 D430G probably benign Het
Ttn T G 2: 76,918,912 Q3931P probably damaging Het
Tuba1c C A 15: 99,037,515 L286I probably benign Het
Usp48 A G 4: 137,621,196 R528G possibly damaging Het
Utrn T C 10: 12,698,123 T1068A probably benign Het
Vmn2r103 A T 17: 19,811,943 T660S probably damaging Het
Vmn2r105 G T 17: 20,224,618 Y537* probably null Het
Vmn2r88 A T 14: 51,418,700 I744F Het
Wnt9b T C 11: 103,730,775 E352G probably damaging Het
Zfp78 A G 7: 6,373,229 N46D probably damaging Het
Other mutations in Cdc42bpg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01149:Cdc42bpg APN 19 6312205 splice site probably benign
IGL01415:Cdc42bpg APN 19 6310851 missense probably damaging 1.00
IGL01517:Cdc42bpg APN 19 6318437 missense probably damaging 1.00
IGL01585:Cdc42bpg APN 19 6320432 missense possibly damaging 0.93
IGL01743:Cdc42bpg APN 19 6309823 critical splice donor site probably null
IGL01930:Cdc42bpg APN 19 6311368 missense probably damaging 1.00
IGL02092:Cdc42bpg APN 19 6316826 splice site probably benign
IGL02355:Cdc42bpg APN 19 6310809 missense possibly damaging 0.93
IGL02362:Cdc42bpg APN 19 6310809 missense possibly damaging 0.93
IGL02498:Cdc42bpg APN 19 6322793 missense probably benign
IGL03004:Cdc42bpg APN 19 6311383 missense probably benign 0.38
IGL03037:Cdc42bpg APN 19 6311200 missense probably damaging 1.00
PIT1430001:Cdc42bpg UTSW 19 6322552 splice site probably null
R0304:Cdc42bpg UTSW 19 6317248 missense probably damaging 0.99
R0367:Cdc42bpg UTSW 19 6311395 missense probably damaging 1.00
R0412:Cdc42bpg UTSW 19 6313457 missense probably damaging 1.00
R0742:Cdc42bpg UTSW 19 6318575 critical splice donor site probably null
R1026:Cdc42bpg UTSW 19 6317187 missense probably damaging 1.00
R1056:Cdc42bpg UTSW 19 6314021 missense probably benign 0.10
R1065:Cdc42bpg UTSW 19 6322826 missense probably damaging 1.00
R1476:Cdc42bpg UTSW 19 6313782 missense probably damaging 0.99
R1854:Cdc42bpg UTSW 19 6320807 missense possibly damaging 0.67
R1936:Cdc42bpg UTSW 19 6310309 missense probably damaging 1.00
R1962:Cdc42bpg UTSW 19 6306855 missense probably damaging 1.00
R2070:Cdc42bpg UTSW 19 6320488 missense probably damaging 1.00
R2167:Cdc42bpg UTSW 19 6317677 missense probably damaging 1.00
R3826:Cdc42bpg UTSW 19 6317645 missense probably damaging 0.99
R3829:Cdc42bpg UTSW 19 6317645 missense probably damaging 0.99
R4190:Cdc42bpg UTSW 19 6321681 missense probably damaging 1.00
R4249:Cdc42bpg UTSW 19 6315266 missense possibly damaging 0.65
R4499:Cdc42bpg UTSW 19 6320555 missense possibly damaging 0.69
R4731:Cdc42bpg UTSW 19 6311191 missense probably damaging 1.00
R4732:Cdc42bpg UTSW 19 6311191 missense probably damaging 1.00
R4733:Cdc42bpg UTSW 19 6311191 missense probably damaging 1.00
R4797:Cdc42bpg UTSW 19 6320447 missense probably damaging 1.00
R4831:Cdc42bpg UTSW 19 6311335 missense probably damaging 0.97
R4984:Cdc42bpg UTSW 19 6316223 missense possibly damaging 0.88
R5092:Cdc42bpg UTSW 19 6313220 missense probably benign 0.01
R5135:Cdc42bpg UTSW 19 6320618 missense probably damaging 1.00
R5183:Cdc42bpg UTSW 19 6321805 intron probably benign
R5208:Cdc42bpg UTSW 19 6321720 missense probably benign 0.01
R5240:Cdc42bpg UTSW 19 6315899 missense probably damaging 1.00
R5475:Cdc42bpg UTSW 19 6311071 missense probably damaging 0.99
R5703:Cdc42bpg UTSW 19 6322673 missense possibly damaging 0.87
R5876:Cdc42bpg UTSW 19 6310815 missense probably damaging 1.00
R6024:Cdc42bpg UTSW 19 6317496 missense probably damaging 1.00
R6266:Cdc42bpg UTSW 19 6311473 missense probably damaging 1.00
R6450:Cdc42bpg UTSW 19 6314488 splice site probably null
R6493:Cdc42bpg UTSW 19 6318455 missense probably damaging 0.96
R6983:Cdc42bpg UTSW 19 6321668 missense probably damaging 1.00
R7080:Cdc42bpg UTSW 19 6315189 missense probably damaging 0.97
R7125:Cdc42bpg UTSW 19 6322291 missense probably damaging 1.00
R7183:Cdc42bpg UTSW 19 6310797 missense probably damaging 1.00
R7317:Cdc42bpg UTSW 19 6314504 missense probably benign 0.11
R7426:Cdc42bpg UTSW 19 6318398 missense probably damaging 1.00
R7504:Cdc42bpg UTSW 19 6306784 missense possibly damaging 0.85
R7530:Cdc42bpg UTSW 19 6322275 missense probably benign 0.21
R7530:Cdc42bpg UTSW 19 6322276 missense probably benign 0.12
R7739:Cdc42bpg UTSW 19 6310815 missense probably damaging 1.00
R7903:Cdc42bpg UTSW 19 6313469 missense possibly damaging 0.94
R7986:Cdc42bpg UTSW 19 6313469 missense possibly damaging 0.94
Z1177:Cdc42bpg UTSW 19 6309746 missense probably damaging 1.00
Z1177:Cdc42bpg UTSW 19 6314522 missense possibly damaging 0.94
Z1177:Cdc42bpg UTSW 19 6314523 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGTTACTTTTCGTGGCCCG -3'
(R):5'- ACCTGTCTCTGGGAGTTTGAAG -3'

Sequencing Primer
(F):5'- TCCCACTTCCTGGACGAG -3'
(R):5'- TTTGAAGTAAGGTGCAGGTGAGC -3'
Posted On2020-07-13