Incidental Mutation 'R8187:Gm19965'
ID634897
Institutional Source Beutler Lab
Gene Symbol Gm19965
Ensembl Gene ENSMUSG00000094429
Gene Namepredicted gene, 19965
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R8187 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location116802983-116823410 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 116821802 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 404 (C404*)
Ref Sequence ENSEMBL: ENSMUSP00000137019 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000179777]
Predicted Effect probably null
Transcript: ENSMUST00000179777
AA Change: C404*
SMART Domains Protein: ENSMUSP00000137019
Gene: ENSMUSG00000094429
AA Change: C404*

DomainStartEndE-ValueType
KRAB 8 68 1.5e-36 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (57/57)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik A T 1: 120,188,183 *122L probably null Het
4930438A08Rik A G 11: 58,289,722 S200G Het
Adgre1 T A 17: 57,420,349 S426R probably benign Het
Adgrg1 A G 8: 95,005,818 E229G probably benign Het
Arhgef39 A T 4: 43,498,999 L84Q probably damaging Het
Bpifb9a A G 2: 154,269,457 I544V probably benign Het
Brwd1 A T 16: 96,002,734 L2079I probably damaging Het
Ccnh T A 13: 85,189,537 M1K probably null Het
Cdh16 T C 8: 104,618,238 N415S probably damaging Het
Chuk T C 19: 44,091,112 N317D probably benign Het
Cnot10 A T 9: 114,597,488 C665* probably null Het
Csmd1 G T 8: 16,127,174 H1358Q probably damaging Het
Cyp4f37 T C 17: 32,635,197 V540A probably benign Het
Daam1 A G 12: 71,895,828 D22G unknown Het
Dhdds A G 4: 134,000,368 probably benign Het
Dnah5 T C 15: 28,384,209 V3033A probably damaging Het
Dync1i2 A G 2: 71,214,521 K25R probably benign Het
Efhc1 T A 1: 20,960,172 S110T probably damaging Het
Emilin3 T C 2: 160,908,080 N583S possibly damaging Het
Eri2 A G 7: 119,785,544 V578A probably damaging Het
F2rl2 A T 13: 95,701,403 I319L probably benign Het
Gjc1 A C 11: 102,800,555 Y207* probably null Het
Gm2832 A T 14: 41,278,958 H51L Het
Gpam T C 19: 55,077,837 T631A probably benign Het
Hdac2 T C 10: 36,988,136 S114P probably damaging Het
Hmha1 G A 10: 80,027,872 A819T probably damaging Het
Hsd3b1 T A 3: 98,852,617 T353S probably damaging Het
Idh1 T C 1: 65,159,541 D390G probably damaging Het
Il1f9 T G 2: 24,192,605 L131V probably damaging Het
Irs1 G T 1: 82,288,300 P732T probably damaging Het
Kansl1l T A 1: 66,801,737 I135F possibly damaging Het
Mcc A G 18: 44,534,260 V208A possibly damaging Het
Mgrn1 A G 16: 4,920,365 N261S probably benign Het
Mybpc2 T A 7: 44,512,470 N519Y possibly damaging Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nr1h5 G T 3: 102,954,670 H94Q probably benign Het
Nsmce4a A G 7: 130,542,789 V128A probably benign Het
Olfr1137 T G 2: 87,711,280 S209R probably benign Het
Olfr220 TTGTGTG TTGTG 1: 174,449,272 probably null Het
Osmr T A 15: 6,821,004 Y707F probably damaging Het
Pck1 G T 2: 173,155,240 R225L probably benign Het
Prom1 A T 5: 44,034,366 L354Q probably damaging Het
Rev3l C A 10: 39,806,697 Q300K probably benign Het
Rin3 T A 12: 102,325,807 C88S unknown Het
Slc37a4 T C 9: 44,399,994 V194A possibly damaging Het
Smpd4 T A 16: 17,629,135 H242Q probably damaging Het
Spen T C 4: 141,472,905 I2804V possibly damaging Het
Srrm4 A C 5: 116,449,621 F359L unknown Het
Svs2 A G 2: 164,237,772 Y72H possibly damaging Het
Tmem158 T A 9: 123,259,810 T246S unknown Het
Ttn A G 2: 76,729,446 I29537T probably damaging Het
Ttn A G 2: 76,795,725 S14997P probably damaging Het
Ttn A G 2: 76,803,391 V14038A probably benign Het
Vmn1r231 A T 17: 20,890,631 D7E probably benign Het
Vmn2r14 A G 5: 109,220,554 S191P probably benign Het
Zfp599 G T 9: 22,249,815 Y351* probably null Het
Zfp729a T A 13: 67,621,799 K104* probably null Het
Other mutations in Gm19965
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0993:Gm19965 UTSW 1 116821825 missense probably benign 0.04
R1016:Gm19965 UTSW 1 116821301 nonsense probably null
R1173:Gm19965 UTSW 1 116820820 splice site probably benign
R1175:Gm19965 UTSW 1 116820820 splice site probably benign
R1335:Gm19965 UTSW 1 116804619 missense possibly damaging 0.79
R1773:Gm19965 UTSW 1 116821259 nonsense probably null
R1802:Gm19965 UTSW 1 116820903 nonsense probably null
R2884:Gm19965 UTSW 1 116821583 missense probably benign 0.14
R3435:Gm19965 UTSW 1 116821623 missense possibly damaging 0.78
R4072:Gm19965 UTSW 1 116821071 missense probably benign 0.17
R4585:Gm19965 UTSW 1 116821778 missense probably benign 0.00
R4801:Gm19965 UTSW 1 116821896 missense probably benign
R4802:Gm19965 UTSW 1 116821896 missense probably benign
R5328:Gm19965 UTSW 1 116821418 missense possibly damaging 0.78
R5856:Gm19965 UTSW 1 116821849 missense probably benign
R5960:Gm19965 UTSW 1 116821471 missense possibly damaging 0.67
R6185:Gm19965 UTSW 1 116821273 missense possibly damaging 0.61
R6297:Gm19965 UTSW 1 116822680 missense possibly damaging 0.82
R6374:Gm19965 UTSW 1 116822291 missense probably benign 0.06
R6811:Gm19965 UTSW 1 116804079 missense probably damaging 1.00
R6860:Gm19965 UTSW 1 116820879 missense probably benign 0.19
R7076:Gm19965 UTSW 1 116821275 missense
R7162:Gm19965 UTSW 1 116822365 missense unknown
R7290:Gm19965 UTSW 1 116821191 missense
R7473:Gm19965 UTSW 1 116821872 missense unknown
R7643:Gm19965 UTSW 1 116822229 missense unknown
R7919:Gm19965 UTSW 1 116822120 nonsense probably null
R8306:Gm19965 UTSW 1 116821785 missense
R8477:Gm19965 UTSW 1 116803124 start gained probably benign
R8751:Gm19965 UTSW 1 116822137 missense unknown
R8876:Gm19965 UTSW 1 116822046 missense unknown
Z1088:Gm19965 UTSW 1 116804600 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- GGAGAGATATTATACCAAGGTAGTGTC -3'
(R):5'- TGGCAAACTTTAAGACTTGAGGAAC -3'

Sequencing Primer
(F):5'- AAATCAGATAAGCAGATACATTCCAG -3'
(R):5'- GAGGAACCAGTAAAGAATTTTCCAC -3'
Posted On2020-07-13