Incidental Mutation 'R8187:Olfr220'
ID634899
Institutional Source Beutler Lab
Gene Symbol Olfr220
Ensembl Gene ENSMUSG00000066671
Gene Nameolfactory receptor 220
SynonymsEG546747, GA_x6K02SYWY4V-595-239, Olfr413-ps1, GA_x6K02T2P20D-20731742-20730694, MOR103-17, MOR103-13P
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R8187 (G1)
Quality Score217.468
Status Validated
Chromosome1
Chromosomal Location174442082-174451277 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) TTGTGTG to TTGTG at 174449272 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141919 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085861] [ENSMUST00000194229]
Predicted Effect probably null
Transcript: ENSMUST00000085861
SMART Domains Protein: ENSMUSP00000083023
Gene: ENSMUSG00000066671

DomainStartEndE-ValueType
Pfam:7tm_4 36 314 1.2e-51 PFAM
Pfam:7tm_1 46 295 3.6e-25 PFAM
low complexity region 315 325 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000194229
SMART Domains Protein: ENSMUSP00000141919
Gene: ENSMUSG00000066671

DomainStartEndE-ValueType
Pfam:7tm_1 46 295 6e-33 PFAM
Pfam:7tm_4 144 288 1.4e-44 PFAM
low complexity region 315 325 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik A T 1: 120,188,183 *122L probably null Het
4930438A08Rik A G 11: 58,289,722 S200G Het
Adgre1 T A 17: 57,420,349 S426R probably benign Het
Adgrg1 A G 8: 95,005,818 E229G probably benign Het
Arhgef39 A T 4: 43,498,999 L84Q probably damaging Het
Bpifb9a A G 2: 154,269,457 I544V probably benign Het
Brwd1 A T 16: 96,002,734 L2079I probably damaging Het
Ccnh T A 13: 85,189,537 M1K probably null Het
Cdh16 T C 8: 104,618,238 N415S probably damaging Het
Chuk T C 19: 44,091,112 N317D probably benign Het
Cnot10 A T 9: 114,597,488 C665* probably null Het
Csmd1 G T 8: 16,127,174 H1358Q probably damaging Het
Cyp4f37 T C 17: 32,635,197 V540A probably benign Het
Daam1 A G 12: 71,895,828 D22G unknown Het
Dhdds A G 4: 134,000,368 probably benign Het
Dnah5 T C 15: 28,384,209 V3033A probably damaging Het
Dync1i2 A G 2: 71,214,521 K25R probably benign Het
Efhc1 T A 1: 20,960,172 S110T probably damaging Het
Emilin3 T C 2: 160,908,080 N583S possibly damaging Het
Eri2 A G 7: 119,785,544 V578A probably damaging Het
F2rl2 A T 13: 95,701,403 I319L probably benign Het
Gjc1 A C 11: 102,800,555 Y207* probably null Het
Gm19965 T A 1: 116,821,802 C404* probably null Het
Gm2832 A T 14: 41,278,958 H51L Het
Gpam T C 19: 55,077,837 T631A probably benign Het
Hdac2 T C 10: 36,988,136 S114P probably damaging Het
Hmha1 G A 10: 80,027,872 A819T probably damaging Het
Hsd3b1 T A 3: 98,852,617 T353S probably damaging Het
Idh1 T C 1: 65,159,541 D390G probably damaging Het
Il1f9 T G 2: 24,192,605 L131V probably damaging Het
Irs1 G T 1: 82,288,300 P732T probably damaging Het
Kansl1l T A 1: 66,801,737 I135F possibly damaging Het
Mcc A G 18: 44,534,260 V208A possibly damaging Het
Mgrn1 A G 16: 4,920,365 N261S probably benign Het
Mybpc2 T A 7: 44,512,470 N519Y possibly damaging Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nr1h5 G T 3: 102,954,670 H94Q probably benign Het
Nsmce4a A G 7: 130,542,789 V128A probably benign Het
Olfr1137 T G 2: 87,711,280 S209R probably benign Het
Osmr T A 15: 6,821,004 Y707F probably damaging Het
Pck1 G T 2: 173,155,240 R225L probably benign Het
Prom1 A T 5: 44,034,366 L354Q probably damaging Het
Rev3l C A 10: 39,806,697 Q300K probably benign Het
Rin3 T A 12: 102,325,807 C88S unknown Het
Slc37a4 T C 9: 44,399,994 V194A possibly damaging Het
Smpd4 T A 16: 17,629,135 H242Q probably damaging Het
Spen T C 4: 141,472,905 I2804V possibly damaging Het
Srrm4 A C 5: 116,449,621 F359L unknown Het
Svs2 A G 2: 164,237,772 Y72H possibly damaging Het
Tmem158 T A 9: 123,259,810 T246S unknown Het
Ttn A G 2: 76,729,446 I29537T probably damaging Het
Ttn A G 2: 76,795,725 S14997P probably damaging Het
Ttn A G 2: 76,803,391 V14038A probably benign Het
Vmn1r231 A T 17: 20,890,631 D7E probably benign Het
Vmn2r14 A G 5: 109,220,554 S191P probably benign Het
Zfp599 G T 9: 22,249,815 Y351* probably null Het
Zfp729a T A 13: 67,621,799 K104* probably null Het
Other mutations in Olfr220
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Olfr220 APN 1 174448667 missense probably benign 0.00
IGL03369:Olfr220 APN 1 174448869 missense probably damaging 1.00
R1792:Olfr220 UTSW 1 174448737 missense probably benign
R4090:Olfr220 UTSW 1 174448934 missense probably benign 0.01
R4169:Olfr220 UTSW 1 174449596 missense unknown
R4769:Olfr220 UTSW 1 174448958 missense possibly damaging 0.80
R6652:Olfr220 UTSW 1 174449061 missense probably damaging 1.00
R6930:Olfr220 UTSW 1 174449111 missense probably damaging 1.00
R7237:Olfr220 UTSW 1 174449339 missense probably benign 0.05
R8039:Olfr220 UTSW 1 174449596 missense unknown
R8518:Olfr220 UTSW 1 174449176 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATGACCAACCAGCTCTGTGG -3'
(R):5'- TGTAGGCATACATGAGCTTAGGAC -3'

Sequencing Primer
(F):5'- CCAACCAGCTCTGTGGAGTAATG -3'
(R):5'- TACATGAGCTTAGGACGGGCATAAG -3'
Posted On2020-07-13