Incidental Mutation 'V1662:Olfr1373'
ID 63492
Institutional Source Beutler Lab
Gene Symbol Olfr1373
Ensembl Gene ENSMUSG00000062204
Gene Name olfactory receptor 1373
Synonyms MOR256-69_p, GA_x6K02T2QP88-3283154-3284089
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock # V1662 () of strain 633
Quality Score 203
Status Not validated
Chromosome 11
Chromosomal Location 52144593-52145528 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 52145177 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 118 (M118V)
Ref Sequence ENSEMBL: ENSMUSP00000077384 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078264]
AlphaFold Q7TQT6
Predicted Effect probably damaging
Transcript: ENSMUST00000078264
AA Change: M118V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000077384
Gene: ENSMUSG00000062204
AA Change: M118V

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 4.7e-46 PFAM
Pfam:7tm_1 41 289 1.1e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181262
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb G C 5: 114,238,708 G1951R probably damaging Het
Adamts12 T A 15: 11,071,808 L146Q probably benign Het
Adgra1 T C 7: 139,852,579 I111T probably damaging Het
Amph G A 13: 19,139,370 V601M probably benign Het
Arfgef1 T C 1: 10,173,253 K1024E probably damaging Het
Arhgef2 G A 3: 88,633,329 R154Q probably damaging Het
Bank1 T A 3: 136,054,418 D782V probably damaging Het
Bhlha9 G T 11: 76,673,036 R163L probably benign Het
Cacna1h T C 17: 25,377,309 N1913D possibly damaging Het
Cd7 T C 11: 121,037,126 I184V probably benign Het
Cdk2ap1 T A 5: 124,348,676 I68F possibly damaging Het
Cfap44 C A 16: 44,449,138 Y1168* probably null Het
D6Ertd527e T C 6: 87,111,892 S346P unknown Het
Daam2 A G 17: 49,464,601 L839P possibly damaging Het
Fam198a A G 9: 121,965,025 R82G probably damaging Het
Gm7030 A G 17: 36,128,931 Y104H probably benign Het
Golgb1 A G 16: 36,898,542 H270R probably benign Het
Itgav C T 2: 83,783,854 R519W possibly damaging Het
Lrp1b A T 2: 41,122,932 I2001K probably damaging Het
Lrrc40 T A 3: 158,052,789 I277K probably damaging Het
Olfr1025-ps1 C A 2: 85,918,594 T223K probably benign Het
Olfr1350 A T 7: 6,570,819 Y276F probably damaging Het
Olfr524 C T 7: 140,201,958 D271N possibly damaging Het
Pyroxd1 G A 6: 142,358,443 G307S probably damaging Het
Rp1 T A 1: 4,349,560 Y443F probably damaging Het
Rpusd4 C A 9: 35,272,761 S237R probably benign Het
Sdk2 A C 11: 113,834,908 W1172G probably damaging Het
Utrn A G 10: 12,421,640 Y675H probably damaging Het
Vmn1r193 A G 13: 22,219,075 I249T possibly damaging Het
Other mutations in Olfr1373
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02277:Olfr1373 APN 11 52145362 missense probably damaging 0.97
IGL02814:Olfr1373 APN 11 52144810 missense probably damaging 1.00
R0490:Olfr1373 UTSW 11 52144666 missense probably damaging 1.00
R1075:Olfr1373 UTSW 11 52144850 missense possibly damaging 0.94
R4050:Olfr1373 UTSW 11 52145134 missense probably damaging 1.00
R5666:Olfr1373 UTSW 11 52144698 nonsense probably null
R6267:Olfr1373 UTSW 11 52144596 missense probably benign 0.28
R6296:Olfr1373 UTSW 11 52144596 missense probably benign 0.28
R6720:Olfr1373 UTSW 11 52144693 missense probably benign 0.18
R6887:Olfr1373 UTSW 11 52145352 missense probably benign 0.01
R8797:Olfr1373 UTSW 11 52145513 missense probably benign 0.05
X0066:Olfr1373 UTSW 11 52145264 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- ACAAATTGACCTCTGTGCCTCCTG -3'
(R):5'- TCTCAGACTGGCCTCACCTAGAAC -3'

Sequencing Primer
(F):5'- CATCTTCAGGAGAACAGGTAGCTC -3'
(R):5'- GACTCTCTTTGGCAACACCG -3'
Posted On 2013-07-30