Incidental Mutation 'R8187:Rev3l'
ID 634929
Institutional Source Beutler Lab
Gene Symbol Rev3l
Ensembl Gene ENSMUSG00000019841
Gene Name REV3 like, DNA directed polymerase zeta catalytic subunit
Synonyms Sez4, Rev
MMRRC Submission 067610-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8187 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 39608114-39751207 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 39682693 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Lysine at position 300 (Q300K)
Ref Sequence ENSEMBL: ENSMUSP00000019986 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019986] [ENSMUST00000131186] [ENSMUST00000164763]
AlphaFold no structure available at present
PDB Structure Structure of the Rev1 CTD-Rev3/7-Pol kappa RIR complex [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000019986
AA Change: Q300K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000019986
Gene: ENSMUSG00000019841
AA Change: Q300K

DomainStartEndE-ValueType
Pfam:DNA_pol_B_exo1 43 201 1.6e-10 PFAM
low complexity region 494 506 N/A INTRINSIC
low complexity region 959 969 N/A INTRINSIC
low complexity region 1042 1057 N/A INTRINSIC
low complexity region 1205 1216 N/A INTRINSIC
low complexity region 1424 1440 N/A INTRINSIC
low complexity region 1569 1595 N/A INTRINSIC
Blast:POLBc 1825 2243 1e-163 BLAST
PDB:4GK5|D 1863 1895 4e-13 PDB
POLBc 2308 2783 5.32e-105 SMART
Blast:POLBc 2860 2926 2e-14 BLAST
Pfam:zf-C4pol 3034 3103 8.2e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131186
Predicted Effect probably benign
Transcript: ENSMUST00000164763
AA Change: Q300K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000131519
Gene: ENSMUSG00000019841
AA Change: Q300K

DomainStartEndE-ValueType
Pfam:DNA_pol_B_exo1 43 200 1.3e-11 PFAM
low complexity region 494 506 N/A INTRINSIC
Pfam:DUF4683 745 1132 1.7e-162 PFAM
low complexity region 1205 1216 N/A INTRINSIC
low complexity region 1424 1440 N/A INTRINSIC
low complexity region 1569 1595 N/A INTRINSIC
Blast:POLBc 1825 2243 1e-163 BLAST
PDB:4GK5|D 1863 1895 4e-13 PDB
POLBc 2308 2783 5.32e-105 SMART
Blast:POLBc 2860 2926 2e-14 BLAST
Pfam:zf-C4pol 3034 3102 6.1e-15 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene represents the catalytic subunit of DNA polymerase zeta, which functions in translesion DNA synthesis. The encoded protein can be found in mitochondria, where it protects DNA from damage. Defects in this gene are a cause of Mobius syndrome. [provided by RefSeq, Jan 2017]
PHENOTYPE: Nullizygous mice exhibit complete embryonic lethality and abnormal embryonic tissue morphology with widespread degeneration and cell death. Mice carrying the amino acid substitution of phenylalanine for leucine at position 2610 display alterations in somatic hypermutation frequency and specificity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik A T 1: 120,115,913 (GRCm39) *122L probably null Het
4930438A08Rik A G 11: 58,180,548 (GRCm39) S200G Het
Adgre1 T A 17: 57,727,349 (GRCm39) S426R probably benign Het
Adgrg1 A G 8: 95,732,446 (GRCm39) E229G probably benign Het
Arhgap45 G A 10: 79,863,706 (GRCm39) A819T probably damaging Het
Arhgef39 A T 4: 43,498,999 (GRCm39) L84Q probably damaging Het
Bpifb9a A G 2: 154,111,377 (GRCm39) I544V probably benign Het
Brwd1 A T 16: 95,803,934 (GRCm39) L2079I probably damaging Het
Ccnh T A 13: 85,337,656 (GRCm39) M1K probably null Het
Cdh16 T C 8: 105,344,870 (GRCm39) N415S probably damaging Het
Chuk T C 19: 44,079,551 (GRCm39) N317D probably benign Het
Cnot10 A T 9: 114,426,556 (GRCm39) C665* probably null Het
Csmd1 G T 8: 16,177,188 (GRCm39) H1358Q probably damaging Het
Cyp4f37 T C 17: 32,854,171 (GRCm39) V540A probably benign Het
Daam1 A G 12: 71,942,602 (GRCm39) D22G unknown Het
Dhdds A G 4: 133,727,679 (GRCm39) probably benign Het
Dnah5 T C 15: 28,384,355 (GRCm39) V3033A probably damaging Het
Dync1i2 A G 2: 71,044,865 (GRCm39) K25R probably benign Het
Efhc1 T A 1: 21,030,396 (GRCm39) S110T probably damaging Het
Emilin3 T C 2: 160,750,000 (GRCm39) N583S possibly damaging Het
Eri2 A G 7: 119,384,767 (GRCm39) V578A probably damaging Het
F2rl2 A T 13: 95,837,911 (GRCm39) I319L probably benign Het
Gjd3 A C 11: 102,691,381 (GRCm39) Y207* probably null Het
Gm19965 T A 1: 116,749,532 (GRCm39) C404* probably null Het
Gm2832 A T 14: 41,000,915 (GRCm39) H51L Het
Gpam T C 19: 55,066,269 (GRCm39) T631A probably benign Het
Hdac2 T C 10: 36,864,132 (GRCm39) S114P probably damaging Het
Hsd3b1 T A 3: 98,759,933 (GRCm39) T353S probably damaging Het
Idh1 T C 1: 65,198,700 (GRCm39) D390G probably damaging Het
Il36g T G 2: 24,082,617 (GRCm39) L131V probably damaging Het
Irs1 G T 1: 82,266,021 (GRCm39) P732T probably damaging Het
Kansl1l T A 1: 66,840,896 (GRCm39) I135F possibly damaging Het
Mcc A G 18: 44,667,327 (GRCm39) V208A possibly damaging Het
Mgrn1 A G 16: 4,738,229 (GRCm39) N261S probably benign Het
Mybpc2 T A 7: 44,161,894 (GRCm39) N519Y possibly damaging Het
Nbeal1 G C 1: 60,276,310 (GRCm39) V684L probably benign Het
Nr1h5 G T 3: 102,861,986 (GRCm39) H94Q probably benign Het
Nsmce4a A G 7: 130,144,519 (GRCm39) V128A probably benign Het
Or5w14 T G 2: 87,541,624 (GRCm39) S209R probably benign Het
Or6y1 TTGTGTG TTGTG 1: 174,276,838 (GRCm39) probably null Het
Osmr T A 15: 6,850,485 (GRCm39) Y707F probably damaging Het
Pck1 G T 2: 172,997,033 (GRCm39) R225L probably benign Het
Prom1 A T 5: 44,191,708 (GRCm39) L354Q probably damaging Het
Rin3 T A 12: 102,292,066 (GRCm39) C88S unknown Het
Slc37a4 T C 9: 44,311,291 (GRCm39) V194A possibly damaging Het
Smpd4 T A 16: 17,446,999 (GRCm39) H242Q probably damaging Het
Spen T C 4: 141,200,216 (GRCm39) I2804V possibly damaging Het
Srrm4 A C 5: 116,587,680 (GRCm39) F359L unknown Het
Svs5 A G 2: 164,079,692 (GRCm39) Y72H possibly damaging Het
Tmem158 T A 9: 123,088,875 (GRCm39) T246S unknown Het
Ttn A G 2: 76,633,735 (GRCm39) V14038A probably benign Het
Ttn A G 2: 76,559,790 (GRCm39) I29537T probably damaging Het
Ttn A G 2: 76,626,069 (GRCm39) S14997P probably damaging Het
Vmn1r231 A T 17: 21,110,893 (GRCm39) D7E probably benign Het
Vmn2r14 A G 5: 109,368,420 (GRCm39) S191P probably benign Het
Zfp599 G T 9: 22,161,111 (GRCm39) Y351* probably null Het
Zfp729a T A 13: 67,769,918 (GRCm39) K104* probably null Het
Other mutations in Rev3l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Rev3l APN 10 39,682,965 (GRCm39) missense probably benign
IGL00815:Rev3l APN 10 39,735,149 (GRCm39) missense possibly damaging 0.79
IGL00964:Rev3l APN 10 39,740,802 (GRCm39) missense probably benign 0.39
IGL01765:Rev3l APN 10 39,704,261 (GRCm39) missense probably benign 0.00
IGL01792:Rev3l APN 10 39,699,336 (GRCm39) missense probably benign
IGL01950:Rev3l APN 10 39,697,153 (GRCm39) missense probably damaging 1.00
IGL01963:Rev3l APN 10 39,698,733 (GRCm39) missense possibly damaging 0.90
IGL02089:Rev3l APN 10 39,701,095 (GRCm39) missense probably damaging 1.00
IGL02288:Rev3l APN 10 39,704,212 (GRCm39) missense probably benign
IGL02381:Rev3l APN 10 39,697,342 (GRCm39) missense possibly damaging 0.83
IGL02409:Rev3l APN 10 39,697,144 (GRCm39) missense possibly damaging 0.75
IGL02434:Rev3l APN 10 39,698,587 (GRCm39) missense probably damaging 1.00
IGL02570:Rev3l APN 10 39,724,009 (GRCm39) missense possibly damaging 0.68
IGL02581:Rev3l APN 10 39,697,277 (GRCm39) missense probably benign 0.10
IGL02654:Rev3l APN 10 39,738,730 (GRCm39) missense probably damaging 1.00
IGL02720:Rev3l APN 10 39,698,391 (GRCm39) nonsense probably null
IGL02746:Rev3l APN 10 39,700,585 (GRCm39) missense probably damaging 0.99
IGL02829:Rev3l APN 10 39,701,236 (GRCm39) missense probably damaging 1.00
IGL02961:Rev3l APN 10 39,703,941 (GRCm39) missense possibly damaging 0.65
IGL02974:Rev3l APN 10 39,738,743 (GRCm39) nonsense probably null
IGL03029:Rev3l APN 10 39,704,482 (GRCm39) missense probably benign 0.34
IGL03153:Rev3l APN 10 39,682,874 (GRCm39) missense probably damaging 1.00
IGL03172:Rev3l APN 10 39,700,786 (GRCm39) missense probably benign 0.10
R0068:Rev3l UTSW 10 39,700,827 (GRCm39) missense possibly damaging 0.68
R0068:Rev3l UTSW 10 39,700,827 (GRCm39) missense possibly damaging 0.68
R0153:Rev3l UTSW 10 39,750,124 (GRCm39) nonsense probably null
R0308:Rev3l UTSW 10 39,700,890 (GRCm39) missense probably benign 0.09
R0355:Rev3l UTSW 10 39,693,282 (GRCm39) missense probably damaging 1.00
R0513:Rev3l UTSW 10 39,704,139 (GRCm39) missense probably benign 0.00
R0523:Rev3l UTSW 10 39,724,045 (GRCm39) missense probably benign 0.02
R0559:Rev3l UTSW 10 39,700,483 (GRCm39) missense probably damaging 1.00
R0761:Rev3l UTSW 10 39,750,191 (GRCm39) missense probably benign 0.32
R1023:Rev3l UTSW 10 39,708,635 (GRCm39) missense probably damaging 1.00
R1159:Rev3l UTSW 10 39,727,921 (GRCm39) nonsense probably null
R1398:Rev3l UTSW 10 39,697,579 (GRCm39) missense probably benign 0.05
R1478:Rev3l UTSW 10 39,659,329 (GRCm39) critical splice donor site probably null
R1517:Rev3l UTSW 10 39,714,439 (GRCm39) missense probably benign 0.34
R1527:Rev3l UTSW 10 39,698,818 (GRCm39) missense probably damaging 1.00
R1635:Rev3l UTSW 10 39,682,658 (GRCm39) missense probably damaging 0.98
R1695:Rev3l UTSW 10 39,700,612 (GRCm39) missense probably damaging 0.97
R1695:Rev3l UTSW 10 39,700,611 (GRCm39) nonsense probably null
R1782:Rev3l UTSW 10 39,675,881 (GRCm39) missense probably benign
R1815:Rev3l UTSW 10 39,698,867 (GRCm39) missense probably benign 0.41
R1818:Rev3l UTSW 10 39,704,420 (GRCm39) missense probably benign 0.05
R2039:Rev3l UTSW 10 39,700,440 (GRCm39) missense probably damaging 1.00
R2071:Rev3l UTSW 10 39,700,349 (GRCm39) missense probably benign 0.17
R2101:Rev3l UTSW 10 39,704,092 (GRCm39) missense probably benign 0.00
R2141:Rev3l UTSW 10 39,724,045 (GRCm39) missense probably benign 0.02
R2883:Rev3l UTSW 10 39,701,152 (GRCm39) missense probably damaging 1.00
R3787:Rev3l UTSW 10 39,722,206 (GRCm39) missense probably damaging 0.97
R3910:Rev3l UTSW 10 39,696,552 (GRCm39) missense probably damaging 1.00
R3912:Rev3l UTSW 10 39,696,552 (GRCm39) missense probably damaging 1.00
R3913:Rev3l UTSW 10 39,696,552 (GRCm39) missense probably damaging 1.00
R4590:Rev3l UTSW 10 39,682,929 (GRCm39) missense probably damaging 1.00
R4631:Rev3l UTSW 10 39,704,412 (GRCm39) missense probably benign 0.44
R4633:Rev3l UTSW 10 39,722,182 (GRCm39) missense probably damaging 1.00
R4707:Rev3l UTSW 10 39,699,393 (GRCm39) missense probably damaging 0.99
R4724:Rev3l UTSW 10 39,722,802 (GRCm39) nonsense probably null
R4810:Rev3l UTSW 10 39,699,721 (GRCm39) missense probably benign 0.01
R4857:Rev3l UTSW 10 39,714,455 (GRCm39) missense probably damaging 1.00
R4882:Rev3l UTSW 10 39,697,456 (GRCm39) missense possibly damaging 0.89
R4928:Rev3l UTSW 10 39,699,981 (GRCm39) missense probably benign 0.30
R4970:Rev3l UTSW 10 39,699,326 (GRCm39) missense probably benign 0.00
R4977:Rev3l UTSW 10 39,699,574 (GRCm39) missense possibly damaging 0.80
R5112:Rev3l UTSW 10 39,699,326 (GRCm39) missense probably benign 0.00
R5261:Rev3l UTSW 10 39,722,725 (GRCm39) missense probably damaging 1.00
R5419:Rev3l UTSW 10 39,700,927 (GRCm39) missense possibly damaging 0.95
R5570:Rev3l UTSW 10 39,728,071 (GRCm39) critical splice donor site probably null
R5628:Rev3l UTSW 10 39,698,963 (GRCm39) missense probably damaging 0.98
R5689:Rev3l UTSW 10 39,670,954 (GRCm39) missense probably damaging 1.00
R5781:Rev3l UTSW 10 39,699,089 (GRCm39) missense probably benign 0.00
R5829:Rev3l UTSW 10 39,682,902 (GRCm39) missense probably damaging 0.97
R5984:Rev3l UTSW 10 39,618,685 (GRCm39) intron probably benign
R5990:Rev3l UTSW 10 39,699,807 (GRCm39) missense probably benign 0.17
R6054:Rev3l UTSW 10 39,700,146 (GRCm39) missense probably benign 0.01
R6171:Rev3l UTSW 10 39,738,709 (GRCm39) nonsense probably null
R6220:Rev3l UTSW 10 39,698,775 (GRCm39) missense probably damaging 1.00
R6520:Rev3l UTSW 10 39,698,698 (GRCm39) missense probably benign 0.06
R6798:Rev3l UTSW 10 39,730,759 (GRCm39) missense probably damaging 1.00
R6811:Rev3l UTSW 10 39,706,917 (GRCm39) nonsense probably null
R6812:Rev3l UTSW 10 39,699,544 (GRCm39) missense probably benign
R6904:Rev3l UTSW 10 39,697,477 (GRCm39) missense probably benign
R6905:Rev3l UTSW 10 39,693,323 (GRCm39) missense probably benign 0.18
R6938:Rev3l UTSW 10 39,738,706 (GRCm39) missense probably damaging 1.00
R7037:Rev3l UTSW 10 39,727,971 (GRCm39) missense probably damaging 1.00
R7124:Rev3l UTSW 10 39,698,163 (GRCm39) nonsense probably null
R7286:Rev3l UTSW 10 39,699,601 (GRCm39) missense probably damaging 0.99
R7385:Rev3l UTSW 10 39,699,678 (GRCm39) missense probably benign 0.01
R7575:Rev3l UTSW 10 39,697,441 (GRCm39) missense possibly damaging 0.56
R7596:Rev3l UTSW 10 39,697,534 (GRCm39) missense probably damaging 1.00
R7597:Rev3l UTSW 10 39,698,880 (GRCm39) missense probably damaging 1.00
R7670:Rev3l UTSW 10 39,712,718 (GRCm39) missense probably benign 0.01
R7804:Rev3l UTSW 10 39,699,481 (GRCm39) missense probably benign 0.34
R7818:Rev3l UTSW 10 39,699,898 (GRCm39) missense possibly damaging 0.54
R7874:Rev3l UTSW 10 39,698,491 (GRCm39) missense possibly damaging 0.72
R7991:Rev3l UTSW 10 39,739,734 (GRCm39) missense possibly damaging 0.52
R8059:Rev3l UTSW 10 39,719,491 (GRCm39) missense probably damaging 1.00
R8174:Rev3l UTSW 10 39,735,111 (GRCm39) missense probably damaging 1.00
R8299:Rev3l UTSW 10 39,697,537 (GRCm39) missense probably benign 0.01
R8352:Rev3l UTSW 10 39,698,899 (GRCm39) missense probably damaging 1.00
R8452:Rev3l UTSW 10 39,698,899 (GRCm39) missense probably damaging 1.00
R8468:Rev3l UTSW 10 39,703,987 (GRCm39) missense probably damaging 0.99
R8487:Rev3l UTSW 10 39,682,844 (GRCm39) missense probably damaging 1.00
R8512:Rev3l UTSW 10 39,697,534 (GRCm39) missense probably damaging 1.00
R8554:Rev3l UTSW 10 39,682,838 (GRCm39) missense probably benign 0.12
R8702:Rev3l UTSW 10 39,714,465 (GRCm39) nonsense probably null
R8848:Rev3l UTSW 10 39,722,705 (GRCm39) missense probably damaging 0.99
R8857:Rev3l UTSW 10 39,670,965 (GRCm39) nonsense probably null
R8870:Rev3l UTSW 10 39,738,786 (GRCm39) missense probably damaging 1.00
R9094:Rev3l UTSW 10 39,700,809 (GRCm39) missense probably benign
R9175:Rev3l UTSW 10 39,730,764 (GRCm39) missense possibly damaging 0.83
R9286:Rev3l UTSW 10 39,682,947 (GRCm39) missense possibly damaging 0.54
R9299:Rev3l UTSW 10 39,723,999 (GRCm39) missense probably damaging 1.00
R9307:Rev3l UTSW 10 39,693,149 (GRCm39) missense probably benign 0.01
R9337:Rev3l UTSW 10 39,698,850 (GRCm39) missense probably benign 0.40
R9342:Rev3l UTSW 10 39,697,458 (GRCm39) missense probably benign
R9389:Rev3l UTSW 10 39,698,967 (GRCm39) missense possibly damaging 0.47
R9395:Rev3l UTSW 10 39,735,219 (GRCm39) critical splice donor site probably null
R9458:Rev3l UTSW 10 39,659,247 (GRCm39) missense probably damaging 1.00
R9481:Rev3l UTSW 10 39,701,033 (GRCm39) missense probably benign
R9646:Rev3l UTSW 10 39,698,440 (GRCm39) missense probably damaging 1.00
R9686:Rev3l UTSW 10 39,743,384 (GRCm39) missense possibly damaging 0.67
X0022:Rev3l UTSW 10 39,704,603 (GRCm39) critical splice donor site probably null
Z1088:Rev3l UTSW 10 39,700,314 (GRCm39) missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- GCATGCCAGAAATGCATTGG -3'
(R):5'- CTCTTGGGATCCATTGCTGTAG -3'

Sequencing Primer
(F):5'- AATAACCTCCATTTCCCTTTTGTATG -3'
(R):5'- GGGATCCATTGCTGTAGTCCAC -3'
Posted On 2020-07-13