Incidental Mutation 'V1662:Bhlha9'
ID 63493
Institutional Source Beutler Lab
Gene Symbol Bhlha9
Ensembl Gene ENSMUSG00000044243
Gene Name basic helix-loop-helix family, member a9
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # V1662 () of strain 633
Quality Score 178
Status Not validated
Chromosome 11
Chromosomal Location 76672470-76673676 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 76673036 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 163 (R163L)
Ref Sequence ENSEMBL: ENSMUSP00000050516 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056184]
AlphaFold Q5RJB0
Predicted Effect probably benign
Transcript: ENSMUST00000056184
AA Change: R163L

PolyPhen 2 Score 0.300 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000050516
Gene: ENSMUSG00000044243
AA Change: R163L

DomainStartEndE-ValueType
low complexity region 7 13 N/A INTRINSIC
low complexity region 44 49 N/A INTRINSIC
HLH 67 119 3.66e-8 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the basic helix-loop-helix family. The encoded protein is a transcription factor involved in limb development. Mutations in this gene have been associated with mesoaxial synostotic syndactyly Malik-Percin type (MSSD). Copy number variation of a locus containing this gene has been linked to a form of split-hand/foot malformation with long bone deficiency (SHFLD3). [provided by RefSeq, Mar 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit variable asymmetrical syndactyly and interdigital webbing due to reduced interdigital apoptosis and incomplete separation of soft, but not skeletal, tissues between forelimb digits 2 and 3. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb G C 5: 114,238,708 G1951R probably damaging Het
Adamts12 T A 15: 11,071,808 L146Q probably benign Het
Adgra1 T C 7: 139,852,579 I111T probably damaging Het
Amph G A 13: 19,139,370 V601M probably benign Het
Arfgef1 T C 1: 10,173,253 K1024E probably damaging Het
Arhgef2 G A 3: 88,633,329 R154Q probably damaging Het
Bank1 T A 3: 136,054,418 D782V probably damaging Het
Cacna1h T C 17: 25,377,309 N1913D possibly damaging Het
Cd7 T C 11: 121,037,126 I184V probably benign Het
Cdk2ap1 T A 5: 124,348,676 I68F possibly damaging Het
Cfap44 C A 16: 44,449,138 Y1168* probably null Het
D6Ertd527e T C 6: 87,111,892 S346P unknown Het
Daam2 A G 17: 49,464,601 L839P possibly damaging Het
Fam198a A G 9: 121,965,025 R82G probably damaging Het
Gm7030 A G 17: 36,128,931 Y104H probably benign Het
Golgb1 A G 16: 36,898,542 H270R probably benign Het
Itgav C T 2: 83,783,854 R519W possibly damaging Het
Lrp1b A T 2: 41,122,932 I2001K probably damaging Het
Lrrc40 T A 3: 158,052,789 I277K probably damaging Het
Olfr1025-ps1 C A 2: 85,918,594 T223K probably benign Het
Olfr1350 A T 7: 6,570,819 Y276F probably damaging Het
Olfr1373 T C 11: 52,145,177 M118V probably damaging Het
Olfr524 C T 7: 140,201,958 D271N possibly damaging Het
Pyroxd1 G A 6: 142,358,443 G307S probably damaging Het
Rp1 T A 1: 4,349,560 Y443F probably damaging Het
Rpusd4 C A 9: 35,272,761 S237R probably benign Het
Sdk2 A C 11: 113,834,908 W1172G probably damaging Het
Utrn A G 10: 12,421,640 Y675H probably damaging Het
Vmn1r193 A G 13: 22,219,075 I249T possibly damaging Het
Other mutations in Bhlha9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01883:Bhlha9 APN 11 76673098 missense probably benign 0.13
IGL02998:Bhlha9 APN 11 76672744 missense probably damaging 1.00
R1537:Bhlha9 UTSW 11 76672631 missense probably benign
R2908:Bhlha9 UTSW 11 76672607 missense probably benign 0.00
R5576:Bhlha9 UTSW 11 76672769 missense probably damaging 1.00
R7284:Bhlha9 UTSW 11 76672666 missense probably benign 0.04
R7728:Bhlha9 UTSW 11 76673089 missense possibly damaging 0.49
R8220:Bhlha9 UTSW 11 76672877 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGAGGCTCTCCAAGATCGCTACG -3'
(R):5'- TGCTCTGTCCAGGATGACTTCTGC -3'

Sequencing Primer
(F):5'- GCATCACTGCTCTATCCTTGG -3'
(R):5'- ATCAAGAGTGCTGGTAGCCC -3'
Posted On 2013-07-30