Incidental Mutation 'R8187:Mgrn1'
ID634941
Institutional Source Beutler Lab
Gene Symbol Mgrn1
Ensembl Gene ENSMUSG00000022517
Gene Namemahogunin, ring finger 1
Synonyms2610042J20Rik, nc
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8187 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location4886249-4938296 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4920365 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 261 (N261S)
Ref Sequence ENSEMBL: ENSMUSP00000023159 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023159] [ENSMUST00000070658]
Predicted Effect probably benign
Transcript: ENSMUST00000023159
AA Change: N261S

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000023159
Gene: ENSMUSG00000022517
AA Change: N261S

DomainStartEndE-ValueType
low complexity region 205 216 N/A INTRINSIC
low complexity region 268 278 N/A INTRINSIC
RING 279 317 4.58e-4 SMART
low complexity region 349 360 N/A INTRINSIC
low complexity region 443 454 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000070658
AA Change: N260S

PolyPhen 2 Score 0.685 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000068314
Gene: ENSMUSG00000022517
AA Change: N260S

DomainStartEndE-ValueType
low complexity region 204 215 N/A INTRINSIC
low complexity region 267 277 N/A INTRINSIC
RING 278 316 4.58e-4 SMART
low complexity region 348 359 N/A INTRINSIC
low complexity region 442 453 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mahogunin (MGRN1) is a C3HC4 RING-containing protein with E3 ubiquitin ligase activity in vitro.[supplied by OMIM, Apr 2004]
PHENOTYPE: Homozygotes for mutant alleles exhibit darkening of agouti hair and suppression of the obesity associated with certain agouti mutations. Homozygotes for an induced null mutation also have curly whiskers and develop a progressive spongiform neuropathology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik A T 1: 120,188,183 *122L probably null Het
4930438A08Rik A G 11: 58,289,722 S200G Het
Adgre1 T A 17: 57,420,349 S426R probably benign Het
Adgrg1 A G 8: 95,005,818 E229G probably benign Het
Arhgef39 A T 4: 43,498,999 L84Q probably damaging Het
Bpifb9a A G 2: 154,269,457 I544V probably benign Het
Brwd1 A T 16: 96,002,734 L2079I probably damaging Het
Ccnh T A 13: 85,189,537 M1K probably null Het
Cdh16 T C 8: 104,618,238 N415S probably damaging Het
Chuk T C 19: 44,091,112 N317D probably benign Het
Cnot10 A T 9: 114,597,488 C665* probably null Het
Csmd1 G T 8: 16,127,174 H1358Q probably damaging Het
Cyp4f37 T C 17: 32,635,197 V540A probably benign Het
Daam1 A G 12: 71,895,828 D22G unknown Het
Dhdds A G 4: 134,000,368 probably benign Het
Dnah5 T C 15: 28,384,209 V3033A probably damaging Het
Dync1i2 A G 2: 71,214,521 K25R probably benign Het
Efhc1 T A 1: 20,960,172 S110T probably damaging Het
Emilin3 T C 2: 160,908,080 N583S possibly damaging Het
Eri2 A G 7: 119,785,544 V578A probably damaging Het
F2rl2 A T 13: 95,701,403 I319L probably benign Het
Gjc1 A C 11: 102,800,555 Y207* probably null Het
Gm19965 T A 1: 116,821,802 C404* probably null Het
Gm2832 A T 14: 41,278,958 H51L Het
Gpam T C 19: 55,077,837 T631A probably benign Het
Hdac2 T C 10: 36,988,136 S114P probably damaging Het
Hmha1 G A 10: 80,027,872 A819T probably damaging Het
Hsd3b1 T A 3: 98,852,617 T353S probably damaging Het
Idh1 T C 1: 65,159,541 D390G probably damaging Het
Il1f9 T G 2: 24,192,605 L131V probably damaging Het
Irs1 G T 1: 82,288,300 P732T probably damaging Het
Kansl1l T A 1: 66,801,737 I135F possibly damaging Het
Mcc A G 18: 44,534,260 V208A possibly damaging Het
Mybpc2 T A 7: 44,512,470 N519Y possibly damaging Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nr1h5 G T 3: 102,954,670 H94Q probably benign Het
Nsmce4a A G 7: 130,542,789 V128A probably benign Het
Olfr1137 T G 2: 87,711,280 S209R probably benign Het
Olfr220 TTGTGTG TTGTG 1: 174,449,272 probably null Het
Osmr T A 15: 6,821,004 Y707F probably damaging Het
Pck1 G T 2: 173,155,240 R225L probably benign Het
Prom1 A T 5: 44,034,366 L354Q probably damaging Het
Rev3l C A 10: 39,806,697 Q300K probably benign Het
Rin3 T A 12: 102,325,807 C88S unknown Het
Slc37a4 T C 9: 44,399,994 V194A possibly damaging Het
Smpd4 T A 16: 17,629,135 H242Q probably damaging Het
Spen T C 4: 141,472,905 I2804V possibly damaging Het
Srrm4 A C 5: 116,449,621 F359L unknown Het
Svs2 A G 2: 164,237,772 Y72H possibly damaging Het
Tmem158 T A 9: 123,259,810 T246S unknown Het
Ttn A G 2: 76,729,446 I29537T probably damaging Het
Ttn A G 2: 76,795,725 S14997P probably damaging Het
Ttn A G 2: 76,803,391 V14038A probably benign Het
Vmn1r231 A T 17: 20,890,631 D7E probably benign Het
Vmn2r14 A G 5: 109,220,554 S191P probably benign Het
Zfp599 G T 9: 22,249,815 Y351* probably null Het
Zfp729a T A 13: 67,621,799 K104* probably null Het
Other mutations in Mgrn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01108:Mgrn1 APN 16 4916155 critical splice donor site probably null
IGL02175:Mgrn1 APN 16 4920368 missense probably benign 0.02
IGL02382:Mgrn1 APN 16 4922618 missense probably damaging 0.97
R1204:Mgrn1 UTSW 16 4907409 missense probably damaging 1.00
R1515:Mgrn1 UTSW 16 4915780 missense probably benign 0.11
R1625:Mgrn1 UTSW 16 4910763 missense probably damaging 1.00
R2875:Mgrn1 UTSW 16 4907416 missense possibly damaging 0.85
R4928:Mgrn1 UTSW 16 4927862 missense probably benign 0.29
R4955:Mgrn1 UTSW 16 4934219 missense probably benign 0.00
R6085:Mgrn1 UTSW 16 4920376 missense probably benign 0.01
R6189:Mgrn1 UTSW 16 4910810 critical splice donor site probably null
R7095:Mgrn1 UTSW 16 4927664 splice site probably null
R7293:Mgrn1 UTSW 16 4932220 missense probably benign 0.01
R7610:Mgrn1 UTSW 16 4934233 makesense probably null
R8376:Mgrn1 UTSW 16 4915766 missense probably damaging 1.00
Z1177:Mgrn1 UTSW 16 4922724 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- GTCTCACAGACTTTCTAGCCAC -3'
(R):5'- GCTTCAGCTGCTGTTTTCAAG -3'

Sequencing Primer
(F):5'- TAGCCACAGTTTCCCTGGG -3'
(R):5'- GCTGTTTTCAAGTAGTCAGTCACAG -3'
Posted On2020-07-13