Incidental Mutation 'R8187:Chuk'
ID634948
Institutional Source Beutler Lab
Gene Symbol Chuk
Ensembl Gene ENSMUSG00000025199
Gene Nameconserved helix-loop-helix ubiquitous kinase
SynonymsChuk1, IKK 1, IKK alpha, IkappaB kinase alpha, IKKalpha, IKK-1, IKK-alpha, IKK[a], IKK1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8187 (G1)
Quality Score184.009
Status Validated
Chromosome19
Chromosomal Location44073335-44107480 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 44091112 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 317 (N317D)
Ref Sequence ENSEMBL: ENSMUSP00000026217 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026217] [ENSMUST00000119591]
Predicted Effect probably benign
Transcript: ENSMUST00000026217
AA Change: N317D

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000026217
Gene: ENSMUSG00000025199
AA Change: N317D

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Pfam:Pkinase_Tyr 15 254 3.5e-39 PFAM
Pfam:Pkinase 15 298 8.3e-55 PFAM
Blast:PHB 589 659 1e-38 BLAST
IKKbetaNEMObind 706 743 1.64e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119591
AA Change: N317D

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000113809
Gene: ENSMUSG00000025199
AA Change: N317D

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Pfam:Pkinase_Tyr 15 253 9.1e-38 PFAM
Pfam:Pkinase 15 298 8.5e-54 PFAM
Blast:PHB 589 659 8e-39 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serine/threonine protein kinase family. The encoded protein, a component of a cytokine-activated protein complex that is an inhibitor of the essential transcription factor NF-kappa-B complex, phosphorylates sites that trigger the degradation of the inhibitor via the ubiquination pathway, thereby activating the transcription factor. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations die neonataly and exhibit thickened, taut, adhesive skin that prevents appendages from protruding from the trunk, absence of whiskers, skeletal abnormalities, and closed esophagus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik A T 1: 120,188,183 *122L probably null Het
4930438A08Rik A G 11: 58,289,722 S200G Het
Adgre1 T A 17: 57,420,349 S426R probably benign Het
Adgrg1 A G 8: 95,005,818 E229G probably benign Het
Arhgef39 A T 4: 43,498,999 L84Q probably damaging Het
Bpifb9a A G 2: 154,269,457 I544V probably benign Het
Brwd1 A T 16: 96,002,734 L2079I probably damaging Het
Ccnh T A 13: 85,189,537 M1K probably null Het
Cdh16 T C 8: 104,618,238 N415S probably damaging Het
Cnot10 A T 9: 114,597,488 C665* probably null Het
Csmd1 G T 8: 16,127,174 H1358Q probably damaging Het
Cyp4f37 T C 17: 32,635,197 V540A probably benign Het
Daam1 A G 12: 71,895,828 D22G unknown Het
Dhdds A G 4: 134,000,368 probably benign Het
Dnah5 T C 15: 28,384,209 V3033A probably damaging Het
Dync1i2 A G 2: 71,214,521 K25R probably benign Het
Efhc1 T A 1: 20,960,172 S110T probably damaging Het
Emilin3 T C 2: 160,908,080 N583S possibly damaging Het
Eri2 A G 7: 119,785,544 V578A probably damaging Het
F2rl2 A T 13: 95,701,403 I319L probably benign Het
Gjc1 A C 11: 102,800,555 Y207* probably null Het
Gm19965 T A 1: 116,821,802 C404* probably null Het
Gm2832 A T 14: 41,278,958 H51L Het
Gpam T C 19: 55,077,837 T631A probably benign Het
Hdac2 T C 10: 36,988,136 S114P probably damaging Het
Hmha1 G A 10: 80,027,872 A819T probably damaging Het
Hsd3b1 T A 3: 98,852,617 T353S probably damaging Het
Idh1 T C 1: 65,159,541 D390G probably damaging Het
Il1f9 T G 2: 24,192,605 L131V probably damaging Het
Irs1 G T 1: 82,288,300 P732T probably damaging Het
Kansl1l T A 1: 66,801,737 I135F possibly damaging Het
Mcc A G 18: 44,534,260 V208A possibly damaging Het
Mgrn1 A G 16: 4,920,365 N261S probably benign Het
Mybpc2 T A 7: 44,512,470 N519Y possibly damaging Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nr1h5 G T 3: 102,954,670 H94Q probably benign Het
Nsmce4a A G 7: 130,542,789 V128A probably benign Het
Olfr1137 T G 2: 87,711,280 S209R probably benign Het
Olfr220 TTGTGTG TTGTG 1: 174,449,272 probably null Het
Osmr T A 15: 6,821,004 Y707F probably damaging Het
Pck1 G T 2: 173,155,240 R225L probably benign Het
Prom1 A T 5: 44,034,366 L354Q probably damaging Het
Rev3l C A 10: 39,806,697 Q300K probably benign Het
Rin3 T A 12: 102,325,807 C88S unknown Het
Slc37a4 T C 9: 44,399,994 V194A possibly damaging Het
Smpd4 T A 16: 17,629,135 H242Q probably damaging Het
Spen T C 4: 141,472,905 I2804V possibly damaging Het
Srrm4 A C 5: 116,449,621 F359L unknown Het
Svs2 A G 2: 164,237,772 Y72H possibly damaging Het
Tmem158 T A 9: 123,259,810 T246S unknown Het
Ttn A G 2: 76,729,446 I29537T probably damaging Het
Ttn A G 2: 76,795,725 S14997P probably damaging Het
Ttn A G 2: 76,803,391 V14038A probably benign Het
Vmn1r231 A T 17: 20,890,631 D7E probably benign Het
Vmn2r14 A G 5: 109,220,554 S191P probably benign Het
Zfp599 G T 9: 22,249,815 Y351* probably null Het
Zfp729a T A 13: 67,621,799 K104* probably null Het
Other mutations in Chuk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Chuk APN 19 44088023 missense possibly damaging 0.56
IGL00585:Chuk APN 19 44078312 missense probably damaging 0.99
IGL00662:Chuk APN 19 44097210 missense possibly damaging 0.64
IGL01419:Chuk APN 19 44096981 missense probably damaging 1.00
IGL01728:Chuk APN 19 44098646 missense possibly damaging 0.94
IGL01753:Chuk APN 19 44098576 splice site probably benign
PIT4362001:Chuk UTSW 19 44098583 critical splice donor site probably null
PIT4382001:Chuk UTSW 19 44098607 missense probably damaging 0.99
R0107:Chuk UTSW 19 44096919 missense probably damaging 1.00
R0107:Chuk UTSW 19 44096919 missense probably damaging 1.00
R0504:Chuk UTSW 19 44081938 splice site probably benign
R0731:Chuk UTSW 19 44103766 splice site probably benign
R0846:Chuk UTSW 19 44091028 missense probably damaging 1.00
R1433:Chuk UTSW 19 44078958 missense probably null 1.00
R1585:Chuk UTSW 19 44077373 missense possibly damaging 0.89
R2020:Chuk UTSW 19 44107343 missense possibly damaging 0.59
R2179:Chuk UTSW 19 44103721 missense possibly damaging 0.95
R2441:Chuk UTSW 19 44096921 missense probably damaging 1.00
R4125:Chuk UTSW 19 44100174 missense probably null 0.00
R4180:Chuk UTSW 19 44101840 missense probably benign 0.01
R4746:Chuk UTSW 19 44088771 missense possibly damaging 0.86
R4815:Chuk UTSW 19 44077247 nonsense probably null
R4852:Chuk UTSW 19 44088758 missense possibly damaging 0.91
R5330:Chuk UTSW 19 44078955 missense probably damaging 1.00
R5331:Chuk UTSW 19 44078955 missense probably damaging 1.00
R5517:Chuk UTSW 19 44097533 critical splice acceptor site probably null
R5854:Chuk UTSW 19 44081957 missense probably benign 0.00
R6149:Chuk UTSW 19 44101831 missense probably damaging 1.00
R6161:Chuk UTSW 19 44082637 missense probably damaging 1.00
R6232:Chuk UTSW 19 44096992 missense probably benign 0.21
R6768:Chuk UTSW 19 44096951 missense probably damaging 0.96
R6865:Chuk UTSW 19 44086915 nonsense probably null
R7916:Chuk UTSW 19 44096981 missense probably damaging 1.00
R8038:Chuk UTSW 19 44078977 missense probably damaging 1.00
R8064:Chuk UTSW 19 44082676 missense probably damaging 1.00
R8272:Chuk UTSW 19 44103736 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- CTAGAACACACTGAGAGGCTG -3'
(R):5'- ATCAGAGGCTCTAAGTACAGGG -3'

Sequencing Primer
(F):5'- AACACACTGAGAGGCTGGTTTCC -3'
(R):5'- CCCCTTCAGTAATCTTTCAG -3'
Posted On2020-07-13