Incidental Mutation 'V1662:Cd7'
ID 63495
Institutional Source Beutler Lab
Gene Symbol Cd7
Ensembl Gene ENSMUSG00000025163
Gene Name CD7 antigen
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # V1662 () of strain 633
Quality Score 181
Status Not validated
Chromosome 11
Chromosomal Location 121036747-121039418 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 121037126 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 184 (I184V)
Ref Sequence ENSEMBL: ENSMUSP00000026159 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026159]
AlphaFold P50283
Predicted Effect probably benign
Transcript: ENSMUST00000026159
AA Change: I184V

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000026159
Gene: ENSMUSG00000025163
AA Change: I184V

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IG 30 129 9.55e-10 SMART
transmembrane domain 149 171 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136500
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163465
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein which is a member of the immunoglobulin superfamily. This protein is found on thymocytes and mature T cells. It plays an essential role in T-cell interactions and also in T-cell/B-cell interaction during early lymphoid development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in a 60% increase of CD4+CD8+ thymocytes at 3 months of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb G C 5: 114,238,708 G1951R probably damaging Het
Adamts12 T A 15: 11,071,808 L146Q probably benign Het
Adgra1 T C 7: 139,852,579 I111T probably damaging Het
Amph G A 13: 19,139,370 V601M probably benign Het
Arfgef1 T C 1: 10,173,253 K1024E probably damaging Het
Arhgef2 G A 3: 88,633,329 R154Q probably damaging Het
Bank1 T A 3: 136,054,418 D782V probably damaging Het
Bhlha9 G T 11: 76,673,036 R163L probably benign Het
Cacna1h T C 17: 25,377,309 N1913D possibly damaging Het
Cdk2ap1 T A 5: 124,348,676 I68F possibly damaging Het
Cfap44 C A 16: 44,449,138 Y1168* probably null Het
D6Ertd527e T C 6: 87,111,892 S346P unknown Het
Daam2 A G 17: 49,464,601 L839P possibly damaging Het
Fam198a A G 9: 121,965,025 R82G probably damaging Het
Gm7030 A G 17: 36,128,931 Y104H probably benign Het
Golgb1 A G 16: 36,898,542 H270R probably benign Het
Itgav C T 2: 83,783,854 R519W possibly damaging Het
Lrp1b A T 2: 41,122,932 I2001K probably damaging Het
Lrrc40 T A 3: 158,052,789 I277K probably damaging Het
Olfr1025-ps1 C A 2: 85,918,594 T223K probably benign Het
Olfr1350 A T 7: 6,570,819 Y276F probably damaging Het
Olfr1373 T C 11: 52,145,177 M118V probably damaging Het
Olfr524 C T 7: 140,201,958 D271N possibly damaging Het
Pyroxd1 G A 6: 142,358,443 G307S probably damaging Het
Rp1 T A 1: 4,349,560 Y443F probably damaging Het
Rpusd4 C A 9: 35,272,761 S237R probably benign Het
Sdk2 A C 11: 113,834,908 W1172G probably damaging Het
Utrn A G 10: 12,421,640 Y675H probably damaging Het
Vmn1r193 A G 13: 22,219,075 I249T possibly damaging Het
Other mutations in Cd7
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0345:Cd7 UTSW 11 121038186 missense probably benign
R1493:Cd7 UTSW 11 121038141 missense probably damaging 1.00
R5204:Cd7 UTSW 11 121038034 critical splice donor site probably null
R5290:Cd7 UTSW 11 121038110 missense probably damaging 1.00
R7195:Cd7 UTSW 11 121038249 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- AGCTTACAGAGGAGGAATCCCACC -3'
(R):5'- AGGCCCCAAAATGAGTGTGTGAAC -3'

Sequencing Primer
(F):5'- CCAAGGGGGAATTTGAGTACC -3'
(R):5'- gctgtgtgagaaaggtcctg -3'
Posted On 2013-07-30