Incidental Mutation 'R8188:Col20a1'
ID 634956
Institutional Source Beutler Lab
Gene Symbol Col20a1
Ensembl Gene ENSMUSG00000016356
Gene Name collagen, type XX, alpha 1
Synonyms 1700051I12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8188 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 180986535-181018363 bp(+) (GRCm38)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 181016333 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000108851] [ENSMUST00000108856] [ENSMUST00000149179]
AlphaFold Q923P0
Predicted Effect probably benign
Transcript: ENSMUST00000108851
SMART Domains Protein: ENSMUSP00000104479
Gene: ENSMUSG00000027577

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:Neur_chan_LBD 39 245 8.4e-79 PFAM
Pfam:Neur_chan_memb 252 620 3.3e-112 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000108856
SMART Domains Protein: ENSMUSP00000104484
Gene: ENSMUSG00000016356

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
FN3 24 103 2.18e1 SMART
VWA 175 354 4.68e-55 SMART
FN3 375 453 6.2e-7 SMART
FN3 464 543 7.34e-9 SMART
FN3 555 633 8.18e-7 SMART
FN3 644 723 8.98e-4 SMART
FN3 738 817 1.43e-11 SMART
TSPN 840 1035 6.45e-31 SMART
Pfam:Collagen 1067 1125 3.8e-9 PFAM
Pfam:Collagen 1122 1174 7.4e-9 PFAM
Pfam:Collagen 1165 1223 3e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149179
SMART Domains Protein: ENSMUSP00000115291
Gene: ENSMUSG00000016356

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
FN3 24 103 2.18e1 SMART
VWA 175 354 4.68e-55 SMART
FN3 375 453 6.2e-7 SMART
FN3 464 543 7.34e-9 SMART
FN3 555 633 8.18e-7 SMART
FN3 644 723 8.98e-4 SMART
FN3 738 817 1.43e-11 SMART
TSPN 840 1035 6.45e-31 SMART
low complexity region 1069 1106 N/A INTRINSIC
low complexity region 1108 1121 N/A INTRINSIC
low complexity region 1136 1155 N/A INTRINSIC
Blast:TSPN 1156 1202 2e-19 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000155425
SMART Domains Protein: ENSMUSP00000114654
Gene: ENSMUSG00000016356

DomainStartEndE-ValueType
Pfam:Collagen 1 55 4.9e-12 PFAM
Pfam:Collagen 36 94 2.2e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000198922
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (56/56)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610001J05Rik C T 6: 13,870,542 G57E probably damaging Het
Aco1 C G 4: 40,180,284 A395G probably benign Het
Adgrf5 G A 17: 43,430,612 C380Y probably damaging Het
Astn2 T C 4: 66,059,181 T422A unknown Het
Baz1b G T 5: 135,205,062 V148F probably benign Het
Bicd1 A C 6: 149,550,356 S823R probably damaging Het
Blvra A C 2: 127,095,127 S167R probably damaging Het
Camsap2 G T 1: 136,297,394 probably null Het
Card14 T C 11: 119,337,797 S650P probably damaging Het
Cdh2 A G 18: 16,648,536 I166T probably damaging Het
Cdnf T C 2: 3,513,191 V22A probably benign Het
Chd2 T A 7: 73,429,756 K1799* probably null Het
Cyp4a31 T C 4: 115,569,746 I182T probably benign Het
Dap3 A T 3: 88,936,236 F25L probably benign Het
Dcc T A 18: 71,810,857 Y241F probably benign Het
Ddx46 A G 13: 55,666,216 I662V possibly damaging Het
Dzip3 T C 16: 48,952,136 D390G probably damaging Het
Eif1 A G 11: 100,320,798 D55G probably benign Het
Exosc5 T A 7: 25,659,365 S44T probably damaging Het
Fat2 A G 11: 55,273,171 V3086A probably damaging Het
Fcamr T A 1: 130,802,928 probably null Het
Gcg T C 2: 62,478,660 D50G probably damaging Het
Gm15448 T C 7: 3,823,127 H289R unknown Het
Gm4788 T A 1: 139,698,130 I869F probably damaging Het
Gm6588 A G 5: 112,450,127 D180G possibly damaging Het
Gm7298 A G 6: 121,786,578 probably null Het
Hfe A G 13: 23,708,192 V63A probably damaging Het
Hoxd11 T A 2: 74,683,954 I276N probably damaging Het
Htt T C 5: 34,761,943 S13P probably benign Het
Il12a T A 3: 68,691,539 C18S unknown Het
Itk G T 11: 46,331,949 Y564* probably null Het
Lrrc46 A T 11: 97,040,879 L39Q probably damaging Het
Myom3 T A 4: 135,779,920 L537Q probably damaging Het
Nrap A C 19: 56,336,578 Y1234* probably null Het
Olfr635 T C 7: 103,979,536 S121P probably damaging Het
Olfr877 A T 9: 37,855,111 M98L probably benign Het
Parn T C 16: 13,541,156 D574G probably benign Het
Pbrm1 A G 14: 31,067,816 I807V probably damaging Het
Pclo T A 5: 14,675,179 S1350R unknown Het
Plaa T C 4: 94,586,349 Q272R probably damaging Het
Rfx6 T A 10: 51,718,196 I174N probably benign Het
Ripk2 T A 4: 16,139,218 K226N probably damaging Het
Scgb1b2 T C 7: 31,291,521 D54G possibly damaging Het
Slc45a4 T C 15: 73,584,534 Y599C probably benign Het
Slc7a13 T C 4: 19,819,082 V94A probably benign Het
Slc7a8 A G 14: 54,735,122 F281L probably benign Het
Slco4c1 T A 1: 96,844,536 T243S probably damaging Het
Stat5b A G 11: 100,801,436 I174T probably damaging Het
Styk1 C A 6: 131,304,885 V257L probably benign Het
Tmem268 T C 4: 63,579,972 F210L probably damaging Het
Ugt2b35 T A 5: 87,001,443 S184R probably damaging Het
Uhrf1bp1l C T 10: 89,812,066 T1330M possibly damaging Het
Vps50 T A 6: 3,562,297 L464* probably null Het
Zfhx2 A T 14: 55,064,441 S2029T probably benign Het
Zfp235 T A 7: 24,141,871 F572I probably damaging Het
Zfp280d T C 9: 72,360,333 I766T probably benign Het
Zfr T G 15: 12,171,818 C933W probably damaging Het
Other mutations in Col20a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00781:Col20a1 APN 2 181003479 missense possibly damaging 0.93
IGL00975:Col20a1 APN 2 180992478 missense probably damaging 1.00
IGL01094:Col20a1 APN 2 180999766 missense probably damaging 0.99
IGL01388:Col20a1 APN 2 181003471 missense probably benign 0.24
IGL01472:Col20a1 APN 2 181007832 missense probably benign 0.44
IGL01936:Col20a1 APN 2 181009368 splice site probably benign
IGL02133:Col20a1 APN 2 181007144 missense probably damaging 1.00
IGL02318:Col20a1 APN 2 181007159 missense probably damaging 0.99
IGL02576:Col20a1 APN 2 181013405 nonsense probably null
IGL02822:Col20a1 APN 2 180996807 missense probably damaging 1.00
IGL02898:Col20a1 APN 2 180989112 nonsense probably null
IGL03056:Col20a1 APN 2 180994889 missense probably damaging 1.00
IGL03189:Col20a1 APN 2 181009407 nonsense probably null
IGL03196:Col20a1 APN 2 181007878 splice site probably null
R0001:Col20a1 UTSW 2 180984412 unclassified probably benign
R0200:Col20a1 UTSW 2 181000438 missense probably damaging 1.00
R0384:Col20a1 UTSW 2 180999162 missense probably benign 0.00
R0964:Col20a1 UTSW 2 180984485 unclassified probably benign
R0975:Col20a1 UTSW 2 181006826 missense possibly damaging 0.75
R1359:Col20a1 UTSW 2 180999792 missense probably benign 0.02
R1395:Col20a1 UTSW 2 180998607 missense probably damaging 0.99
R1470:Col20a1 UTSW 2 180994960 missense probably benign 0.01
R1470:Col20a1 UTSW 2 180994960 missense probably benign 0.01
R1508:Col20a1 UTSW 2 180992577 missense probably damaging 0.98
R1865:Col20a1 UTSW 2 181015813 missense possibly damaging 0.87
R1883:Col20a1 UTSW 2 180992910 missense possibly damaging 0.52
R1884:Col20a1 UTSW 2 180992910 missense possibly damaging 0.52
R1906:Col20a1 UTSW 2 180998697 missense probably benign 0.00
R2020:Col20a1 UTSW 2 181013163 critical splice donor site probably null
R2121:Col20a1 UTSW 2 180996456 missense probably damaging 0.99
R2131:Col20a1 UTSW 2 180992573 missense probably damaging 1.00
R2343:Col20a1 UTSW 2 181001331 missense possibly damaging 0.73
R3153:Col20a1 UTSW 2 181008593 missense probably damaging 1.00
R3430:Col20a1 UTSW 2 181013285 nonsense probably null
R3547:Col20a1 UTSW 2 180994911 missense probably damaging 1.00
R3844:Col20a1 UTSW 2 180992449 missense probably damaging 1.00
R3914:Col20a1 UTSW 2 180998492 missense probably benign 0.00
R4414:Col20a1 UTSW 2 181001250 missense possibly damaging 0.92
R4711:Col20a1 UTSW 2 180992491 missense probably damaging 1.00
R4760:Col20a1 UTSW 2 180984403 unclassified probably benign
R4771:Col20a1 UTSW 2 180989124 missense probably benign 0.17
R4809:Col20a1 UTSW 2 180998661 missense probably damaging 1.00
R4872:Col20a1 UTSW 2 180997363 missense possibly damaging 0.74
R5045:Col20a1 UTSW 2 181006845 missense probably damaging 1.00
R5238:Col20a1 UTSW 2 180998586 missense probably damaging 1.00
R5566:Col20a1 UTSW 2 180986523 splice site probably null
R6389:Col20a1 UTSW 2 180992583 splice site probably null
R6422:Col20a1 UTSW 2 181014819 missense possibly damaging 0.75
R6924:Col20a1 UTSW 2 180996850 missense probably damaging 1.00
R6982:Col20a1 UTSW 2 180996706 missense probably benign 0.00
R7177:Col20a1 UTSW 2 180994214 nonsense probably null
R7195:Col20a1 UTSW 2 181007231 missense probably damaging 1.00
R7717:Col20a1 UTSW 2 181007615 missense probably damaging 1.00
R7872:Col20a1 UTSW 2 180986578 missense probably benign 0.14
R8183:Col20a1 UTSW 2 180998414 missense
R8331:Col20a1 UTSW 2 180996766 missense possibly damaging 0.95
R8423:Col20a1 UTSW 2 180998705 missense probably damaging 1.00
R8803:Col20a1 UTSW 2 181001338 missense possibly damaging 0.75
R8849:Col20a1 UTSW 2 180998639 missense probably damaging 1.00
R8855:Col20a1 UTSW 2 181013891 missense
R8885:Col20a1 UTSW 2 180998503 splice site probably benign
R9160:Col20a1 UTSW 2 180999745 missense probably benign
R9223:Col20a1 UTSW 2 181006735 missense probably damaging 1.00
R9697:Col20a1 UTSW 2 180999784 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATGCTTCTCCCAAGAGGACC -3'
(R):5'- CCATTATAGGGCTTCTCCAAGAC -3'

Sequencing Primer
(F):5'- GACCCAGCCTTCCTCTGACAG -3'
(R):5'- TTCTCCAAGACCCGTGAGC -3'
Posted On 2020-07-13