Incidental Mutation 'R8188:Ugt2b35'
ID634969
Institutional Source Beutler Lab
Gene Symbol Ugt2b35
Ensembl Gene ENSMUSG00000035811
Gene NameUDP glucuronosyltransferase 2 family, polypeptide B35
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R8188 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location87000860-87013275 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 87001443 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 184 (S184R)
Ref Sequence ENSEMBL: ENSMUSP00000031186 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031186]
Predicted Effect probably damaging
Transcript: ENSMUST00000031186
AA Change: S184R

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000031186
Gene: ENSMUSG00000035811
AA Change: S184R

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:UDPGT 24 526 1e-253 PFAM
Pfam:Glyco_tran_28_C 338 449 1.9e-8 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (56/56)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610001J05Rik C T 6: 13,870,542 G57E probably damaging Het
Aco1 C G 4: 40,180,284 A395G probably benign Het
Adgrf5 G A 17: 43,430,612 C380Y probably damaging Het
Astn2 T C 4: 66,059,181 T422A unknown Het
Baz1b G T 5: 135,205,062 V148F probably benign Het
Bicd1 A C 6: 149,550,356 S823R probably damaging Het
Blvra A C 2: 127,095,127 S167R probably damaging Het
Camsap2 G T 1: 136,297,394 probably null Het
Card14 T C 11: 119,337,797 S650P probably damaging Het
Cdh2 A G 18: 16,648,536 I166T probably damaging Het
Cdnf T C 2: 3,513,191 V22A probably benign Het
Chd2 T A 7: 73,429,756 K1799* probably null Het
Col20a1 G A 2: 181,016,333 probably null Het
Cyp4a31 T C 4: 115,569,746 I182T probably benign Het
Dap3 A T 3: 88,936,236 F25L probably benign Het
Dcc T A 18: 71,810,857 Y241F probably benign Het
Ddx46 A G 13: 55,666,216 I662V possibly damaging Het
Dzip3 T C 16: 48,952,136 D390G probably damaging Het
Eif1 A G 11: 100,320,798 D55G probably benign Het
Exosc5 T A 7: 25,659,365 S44T probably damaging Het
Fat2 A G 11: 55,273,171 V3086A probably damaging Het
Fcamr T A 1: 130,802,928 probably null Het
Gcg T C 2: 62,478,660 D50G probably damaging Het
Gm15448 T C 7: 3,823,127 H289R unknown Het
Gm4788 T A 1: 139,698,130 I869F probably damaging Het
Gm6588 A G 5: 112,450,127 D180G possibly damaging Het
Gm7298 A G 6: 121,786,578 probably null Het
Hfe A G 13: 23,708,192 V63A probably damaging Het
Hoxd11 T A 2: 74,683,954 I276N probably damaging Het
Htt T C 5: 34,761,943 S13P probably benign Het
Il12a T A 3: 68,691,539 C18S unknown Het
Itk G T 11: 46,331,949 Y564* probably null Het
Lrrc46 A T 11: 97,040,879 L39Q probably damaging Het
Myom3 T A 4: 135,779,920 L537Q probably damaging Het
Nrap A C 19: 56,336,578 Y1234* probably null Het
Olfr635 T C 7: 103,979,536 S121P probably damaging Het
Olfr877 A T 9: 37,855,111 M98L probably benign Het
Parn T C 16: 13,541,156 D574G probably benign Het
Pbrm1 A G 14: 31,067,816 I807V probably damaging Het
Pclo T A 5: 14,675,179 S1350R unknown Het
Plaa T C 4: 94,586,349 Q272R probably damaging Het
Rfx6 T A 10: 51,718,196 I174N probably benign Het
Ripk2 T A 4: 16,139,218 K226N probably damaging Het
Scgb1b2 T C 7: 31,291,521 D54G possibly damaging Het
Slc45a4 T C 15: 73,584,534 Y599C probably benign Het
Slc7a13 T C 4: 19,819,082 V94A probably benign Het
Slc7a8 A G 14: 54,735,122 F281L probably benign Het
Slco4c1 T A 1: 96,844,536 T243S probably damaging Het
Stat5b A G 11: 100,801,436 I174T probably damaging Het
Styk1 C A 6: 131,304,885 V257L probably benign Het
Tmem268 T C 4: 63,579,972 F210L probably damaging Het
Uhrf1bp1l C T 10: 89,812,066 T1330M possibly damaging Het
Vps50 T A 6: 3,562,297 L464* probably null Het
Zfhx2 A T 14: 55,064,441 S2029T probably benign Het
Zfp235 T A 7: 24,141,871 F572I probably damaging Het
Zfp280d T C 9: 72,360,333 I766T probably benign Het
Zfr T G 15: 12,171,818 C933W probably damaging Het
Other mutations in Ugt2b35
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00703:Ugt2b35 APN 5 87008192 missense probably benign 0.00
IGL01109:Ugt2b35 APN 5 87008306 missense probably damaging 1.00
IGL01586:Ugt2b35 APN 5 87011391 missense probably benign 0.07
IGL02151:Ugt2b35 APN 5 87003282 missense possibly damaging 0.65
IGL02225:Ugt2b35 APN 5 87007405 splice site probably benign
IGL02483:Ugt2b35 APN 5 87001145 missense possibly damaging 0.87
IGL02504:Ugt2b35 APN 5 87001541 missense possibly damaging 0.50
IGL02690:Ugt2b35 APN 5 87001237 missense probably benign 0.01
IGL02954:Ugt2b35 APN 5 87011321 missense probably benign 0.00
IGL03242:Ugt2b35 APN 5 87007395 missense probably damaging 1.00
R0329:Ugt2b35 UTSW 5 87003405 missense probably null 0.38
R0513:Ugt2b35 UTSW 5 87003412 splice site probably benign
R0571:Ugt2b35 UTSW 5 87000934 missense possibly damaging 0.51
R0827:Ugt2b35 UTSW 5 87008130 splice site probably benign
R1396:Ugt2b35 UTSW 5 87011530 missense possibly damaging 0.56
R1437:Ugt2b35 UTSW 5 87001031 missense probably benign 0.02
R1557:Ugt2b35 UTSW 5 87007297 splice site probably null
R1869:Ugt2b35 UTSW 5 87001288 missense probably damaging 1.00
R1937:Ugt2b35 UTSW 5 87001282 missense probably damaging 1.00
R2067:Ugt2b35 UTSW 5 87001553 missense probably damaging 1.00
R2219:Ugt2b35 UTSW 5 87003332 missense possibly damaging 0.81
R3055:Ugt2b35 UTSW 5 87001598 missense probably benign 0.05
R3793:Ugt2b35 UTSW 5 87001606 missense probably benign 0.15
R4452:Ugt2b35 UTSW 5 87003378 missense probably damaging 0.99
R4548:Ugt2b35 UTSW 5 87008275 nonsense probably null
R4902:Ugt2b35 UTSW 5 87003300 missense possibly damaging 0.89
R5311:Ugt2b35 UTSW 5 87011280 nonsense probably null
R6187:Ugt2b35 UTSW 5 87007322 missense probably damaging 0.98
R6332:Ugt2b35 UTSW 5 87001556 missense probably damaging 1.00
R6719:Ugt2b35 UTSW 5 87007388 missense probably damaging 1.00
R7211:Ugt2b35 UTSW 5 87001318 missense probably benign 0.39
R7652:Ugt2b35 UTSW 5 87001510 missense probably damaging 0.99
R7766:Ugt2b35 UTSW 5 87001202 missense possibly damaging 0.94
R7825:Ugt2b35 UTSW 5 87001359 nonsense probably null
R8189:Ugt2b35 UTSW 5 87001443 missense probably damaging 0.98
R8191:Ugt2b35 UTSW 5 87001443 missense probably damaging 0.98
R8192:Ugt2b35 UTSW 5 87001443 missense probably damaging 0.98
R8193:Ugt2b35 UTSW 5 87001443 missense probably damaging 0.98
R8220:Ugt2b35 UTSW 5 87001443 missense probably damaging 0.98
R8288:Ugt2b35 UTSW 5 87001457 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCTAAGTCTTTGTAAGGAAGCTG -3'
(R):5'- ATGTGTAGCTAGGGATATCAAGC -3'

Sequencing Primer
(F):5'- GTCTTTGTAAGGAAGCTGTTTCAAAC -3'
(R):5'- GTAGCTAGGGATATCAAGCTACTAAG -3'
Posted On2020-07-13