Incidental Mutation 'V1662:Vmn1r193'
ID 63497
Institutional Source Beutler Lab
Gene Symbol Vmn1r193
Ensembl Gene ENSMUSG00000046932
Gene Name vomeronasal 1 receptor 193
Synonyms V1ri9
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock # V1662 () of strain 633
Quality Score 146
Status Not validated
Chromosome 13
Chromosomal Location 22213672-22223160 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 22219075 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 249 (I249T)
Ref Sequence ENSEMBL: ENSMUSP00000154019 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057516] [ENSMUST00000227457] [ENSMUST00000227562] [ENSMUST00000228303]
AlphaFold Q8R258
Predicted Effect possibly damaging
Transcript: ENSMUST00000057516
AA Change: I249T

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000058480
Gene: ENSMUSG00000046932
AA Change: I249T

DomainStartEndE-ValueType
Pfam:TAS2R 23 317 4.4e-8 PFAM
Pfam:V1R 52 315 5.1e-36 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000227457
AA Change: I249T

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000227562
AA Change: I249T

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000228303
AA Change: I249T

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb G C 5: 114,238,708 G1951R probably damaging Het
Adamts12 T A 15: 11,071,808 L146Q probably benign Het
Adgra1 T C 7: 139,852,579 I111T probably damaging Het
Amph G A 13: 19,139,370 V601M probably benign Het
Arfgef1 T C 1: 10,173,253 K1024E probably damaging Het
Arhgef2 G A 3: 88,633,329 R154Q probably damaging Het
Bank1 T A 3: 136,054,418 D782V probably damaging Het
Bhlha9 G T 11: 76,673,036 R163L probably benign Het
Cacna1h T C 17: 25,377,309 N1913D possibly damaging Het
Cd7 T C 11: 121,037,126 I184V probably benign Het
Cdk2ap1 T A 5: 124,348,676 I68F possibly damaging Het
Cfap44 C A 16: 44,449,138 Y1168* probably null Het
D6Ertd527e T C 6: 87,111,892 S346P unknown Het
Daam2 A G 17: 49,464,601 L839P possibly damaging Het
Fam198a A G 9: 121,965,025 R82G probably damaging Het
Gm7030 A G 17: 36,128,931 Y104H probably benign Het
Golgb1 A G 16: 36,898,542 H270R probably benign Het
Itgav C T 2: 83,783,854 R519W possibly damaging Het
Lrp1b A T 2: 41,122,932 I2001K probably damaging Het
Lrrc40 T A 3: 158,052,789 I277K probably damaging Het
Olfr1025-ps1 C A 2: 85,918,594 T223K probably benign Het
Olfr1350 A T 7: 6,570,819 Y276F probably damaging Het
Olfr1373 T C 11: 52,145,177 M118V probably damaging Het
Olfr524 C T 7: 140,201,958 D271N possibly damaging Het
Pyroxd1 G A 6: 142,358,443 G307S probably damaging Het
Rp1 T A 1: 4,349,560 Y443F probably damaging Het
Rpusd4 C A 9: 35,272,761 S237R probably benign Het
Sdk2 A C 11: 113,834,908 W1172G probably damaging Het
Utrn A G 10: 12,421,640 Y675H probably damaging Het
Other mutations in Vmn1r193
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01642:Vmn1r193 APN 13 22219624 missense probably damaging 1.00
IGL01862:Vmn1r193 APN 13 22219814 missense probably benign 0.00
IGL01939:Vmn1r193 APN 13 22219723 nonsense probably null
IGL03394:Vmn1r193 APN 13 22219769 missense probably benign 0.02
R0158:Vmn1r193 UTSW 13 22219628 missense probably damaging 1.00
R1830:Vmn1r193 UTSW 13 22219391 missense probably benign
R2035:Vmn1r193 UTSW 13 22219562 missense probably benign 0.37
R4651:Vmn1r193 UTSW 13 22219525 missense probably damaging 1.00
R4652:Vmn1r193 UTSW 13 22219525 missense probably damaging 1.00
R5298:Vmn1r193 UTSW 13 22219555 missense probably damaging 1.00
R5865:Vmn1r193 UTSW 13 22219225 missense probably damaging 1.00
R6208:Vmn1r193 UTSW 13 22218968 missense possibly damaging 0.57
R6958:Vmn1r193 UTSW 13 22219974 start gained probably benign
R8095:Vmn1r193 UTSW 13 22219061 missense possibly damaging 0.89
R8128:Vmn1r193 UTSW 13 22218943 missense probably damaging 1.00
R8211:Vmn1r193 UTSW 13 22219116 nonsense probably null
R8308:Vmn1r193 UTSW 13 22218976 missense probably benign 0.00
R8889:Vmn1r193 UTSW 13 22219669 missense probably benign 0.05
R8949:Vmn1r193 UTSW 13 22219750 missense possibly damaging 0.89
R9138:Vmn1r193 UTSW 13 22219674 missense probably damaging 0.99
R9364:Vmn1r193 UTSW 13 22219819 start codon destroyed probably null 0.02
Z1177:Vmn1r193 UTSW 13 22219456 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATATTGCTCAGGGGACACAGCAGG -3'
(R):5'- ATATGCTGCCATCCAGGCACAC -3'

Sequencing Primer
(F):5'- ATCCTTGATGATCAGGATAAAAGGGC -3'
(R):5'- TCCAGGCACACAGTTAAGTG -3'
Posted On 2013-07-30