Incidental Mutation 'R8188:Olfr635'
ID634982
Institutional Source Beutler Lab
Gene Symbol Olfr635
Ensembl Gene ENSMUSG00000094520
Gene Nameolfactory receptor 635
SynonymsGA_x6K02T2PBJ9-6713641-6714588, MOR5-2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R8188 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location103971152-103987540 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 103979536 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 121 (S121P)
Ref Sequence ENSEMBL: ENSMUSP00000095788 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098185] [ENSMUST00000209473]
Predicted Effect probably damaging
Transcript: ENSMUST00000098185
AA Change: S121P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095788
Gene: ENSMUSG00000094520
AA Change: S121P

DomainStartEndE-ValueType
Pfam:7tm_4 39 318 1.2e-119 PFAM
Pfam:7TM_GPCR_Srsx 43 182 1.3e-9 PFAM
Pfam:7tm_1 49 300 1.9e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000209473
AA Change: S115P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610001J05Rik C T 6: 13,870,542 G57E probably damaging Het
Aco1 C G 4: 40,180,284 A395G probably benign Het
Adgrf5 G A 17: 43,430,612 C380Y probably damaging Het
Astn2 T C 4: 66,059,181 T422A unknown Het
Baz1b G T 5: 135,205,062 V148F probably benign Het
Bicd1 A C 6: 149,550,356 S823R probably damaging Het
Blvra A C 2: 127,095,127 S167R probably damaging Het
Card14 T C 11: 119,337,797 S650P probably damaging Het
Cdh2 A G 18: 16,648,536 I166T probably damaging Het
Cdnf T C 2: 3,513,191 V22A probably benign Het
Chd2 T A 7: 73,429,756 K1799* probably null Het
Col20a1 G A 2: 181,016,333 probably null Het
Cyp4a31 T C 4: 115,569,746 I182T probably benign Het
Dap3 A T 3: 88,936,236 F25L probably benign Het
Dcc T A 18: 71,810,857 Y241F probably benign Het
Ddx46 A G 13: 55,666,216 I662V possibly damaging Het
Dzip3 T C 16: 48,952,136 D390G probably damaging Het
Eif1 A G 11: 100,320,798 D55G probably benign Het
Exosc5 T A 7: 25,659,365 S44T probably damaging Het
Fat2 A G 11: 55,273,171 V3086A probably damaging Het
Gcg T C 2: 62,478,660 D50G probably damaging Het
Gm15448 T C 7: 3,823,127 H289R unknown Het
Gm4788 T A 1: 139,698,130 I869F probably damaging Het
Gm6588 A G 5: 112,450,127 D180G possibly damaging Het
Gm7298 A G 6: 121,786,578 probably null Het
Hfe A G 13: 23,708,192 V63A probably damaging Het
Hoxd11 T A 2: 74,683,954 I276N probably damaging Het
Htt T C 5: 34,761,943 S13P probably benign Het
Il12a T A 3: 68,691,539 C18S unknown Het
Itk G T 11: 46,331,949 Y564* probably null Het
Lrrc46 A T 11: 97,040,879 L39Q probably damaging Het
Myom3 T A 4: 135,779,920 L537Q probably damaging Het
Nrap A C 19: 56,336,578 Y1234* probably null Het
Olfr877 A T 9: 37,855,111 M98L probably benign Het
Parn T C 16: 13,541,156 D574G probably benign Het
Pbrm1 A G 14: 31,067,816 I807V probably damaging Het
Pclo T A 5: 14,675,179 S1350R unknown Het
Plaa T C 4: 94,586,349 Q272R probably damaging Het
Rfx6 T A 10: 51,718,196 I174N probably benign Het
Ripk2 T A 4: 16,139,218 K226N probably damaging Het
Scgb1b2 T C 7: 31,291,521 D54G possibly damaging Het
Slc45a4 T C 15: 73,584,534 Y599C probably benign Het
Slc7a13 T C 4: 19,819,082 V94A probably benign Het
Slc7a8 A G 14: 54,735,122 F281L probably benign Het
Slco4c1 T A 1: 96,844,536 T243S probably damaging Het
Stat5b A G 11: 100,801,436 I174T probably damaging Het
Styk1 C A 6: 131,304,885 V257L probably benign Het
Tmem268 T C 4: 63,579,972 F210L probably damaging Het
Ugt2b35 T A 5: 87,001,443 S184R probably damaging Het
Uhrf1bp1l C T 10: 89,812,066 T1330M possibly damaging Het
Vps50 T A 6: 3,562,297 L464* probably null Het
Zfhx2 A T 14: 55,064,441 S2029T probably benign Het
Zfp235 T A 7: 24,141,871 F572I probably damaging Het
Zfp280d T C 9: 72,360,333 I766T probably benign Het
Zfr T G 15: 12,171,818 C933W probably damaging Het
Other mutations in Olfr635
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01064:Olfr635 APN 7 103979792 missense probably benign 0.09
IGL01330:Olfr635 APN 7 103980142 utr 3 prime probably benign
IGL01433:Olfr635 APN 7 103979332 missense probably damaging 1.00
FR4304:Olfr635 UTSW 7 103979903 frame shift probably null
FR4340:Olfr635 UTSW 7 103979903 frame shift probably null
FR4342:Olfr635 UTSW 7 103979903 frame shift probably null
R0271:Olfr635 UTSW 7 103979630 missense possibly damaging 0.83
R1909:Olfr635 UTSW 7 103979790 nonsense probably null
R2212:Olfr635 UTSW 7 103979402 missense probably damaging 0.98
R2484:Olfr635 UTSW 7 103979338 missense probably benign
R3412:Olfr635 UTSW 7 103979402 missense probably damaging 0.98
R4513:Olfr635 UTSW 7 103979441 missense probably benign 0.03
R4559:Olfr635 UTSW 7 103979560 missense probably damaging 1.00
R5032:Olfr635 UTSW 7 103979374 missense probably damaging 0.98
R5436:Olfr635 UTSW 7 103979266 missense probably benign
R5591:Olfr635 UTSW 7 103980113 missense probably benign 0.00
R5617:Olfr635 UTSW 7 103979714 missense possibly damaging 0.91
R5911:Olfr635 UTSW 7 103979708 missense probably benign
R6249:Olfr635 UTSW 7 103979611 missense possibly damaging 0.85
R6275:Olfr635 UTSW 7 103979974 missense probably damaging 1.00
R6806:Olfr635 UTSW 7 103979564 missense possibly damaging 0.72
R7589:Olfr635 UTSW 7 103979791 missense probably damaging 1.00
R8337:Olfr635 UTSW 7 103979374 missense probably damaging 0.98
RF004:Olfr635 UTSW 7 103979903 frame shift probably null
RF005:Olfr635 UTSW 7 103979561 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATCCGCACAGAGCCATCTC -3'
(R):5'- ATATCCTGGTGGAGGCAGTAGG -3'

Sequencing Primer
(F):5'- ATCTCTCCACCAGCCCATGTAC -3'
(R):5'- TGGAGGCAGTAGGAGTGAG -3'
Posted On2020-07-13