Incidental Mutation 'R8188:Itk'
ID634987
Institutional Source Beutler Lab
Gene Symbol Itk
Ensembl Gene ENSMUSG00000020395
Gene NameIL2 inducible T cell kinase
SynonymsEmt, Tsk, Tcsk
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.146) question?
Stock #R8188 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location46325150-46389515 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 46331949 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 564 (Y564*)
Ref Sequence ENSEMBL: ENSMUSP00000104860 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020664] [ENSMUST00000109237]
PDB Structure INTRAMOLECULAR ITK-PROLINE COMPLEX, NMR, MINIMIZED AVERAGE STRUCTURE [SOLUTION NMR]
NMR Structures of Itk SH2 domain, Pro287cis isoform, ensemble of 20 low energy structures [SOLUTION NMR]
NMR Structure of the Itk SH2 domain, Pro287cis, Energy minimized average structure [SOLUTION NMR]
NMR Structure of the Itk SH2 domain, Pro287trans, 20 low energy structures [SOLUTION NMR]
NMR Structure of the Itk SH2 domain, Pro287trans, energy minimized average structure [SOLUTION NMR]
The NMR minimized average structure of the Itk SH2 domain bound to a phosphopeptide [SOLUTION NMR]
The NMR ensemble structure of the Itk SH2 domain bound to a phosphopeptide [SOLUTION NMR]
Solution Structure of the binary complex between the SH3 and SH2 domain of interleukin-2 tyrosine kinase [SOLUTION NMR]
Ensemble Structures of the binary complex between the SH3 and SH2 domain of interleukin-2 tyrosine kinase. [SOLUTION NMR]
NMR structure note: murine Itk SH3 domain [SOLUTION NMR]
>> 2 additional structures at PDB <<
Predicted Effect probably null
Transcript: ENSMUST00000020664
AA Change: Y558*
SMART Domains Protein: ENSMUSP00000020664
Gene: ENSMUSG00000020395
AA Change: Y558*

DomainStartEndE-ValueType
PH 5 113 2.3e-13 SMART
BTK 113 149 1.1e-21 SMART
SH3 174 230 5.87e-14 SMART
SH2 237 328 9.44e-29 SMART
TyrKc 362 611 3.28e-133 SMART
Predicted Effect probably null
Transcript: ENSMUST00000109237
AA Change: Y564*
SMART Domains Protein: ENSMUSP00000104860
Gene: ENSMUSG00000020395
AA Change: Y564*

DomainStartEndE-ValueType
PH 5 119 3.94e-12 SMART
BTK 119 155 1.1e-21 SMART
SH3 180 236 5.87e-14 SMART
SH2 243 334 9.44e-29 SMART
TyrKc 368 617 3.28e-133 SMART
Meta Mutation Damage Score 0.9756 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an intracellular tyrosine kinase expressed in T-cells. The protein contains both SH2 and SH3 domains which are often found in intracellular kinases. It is thought to play a role in T-cell proliferation and differentiation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display decreased percentages of CD4 and CD8 cells, increased percentage of B cells, impaired T cell receptor signaling, and increased susceptibility to Toxoplasma gondii infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610001J05Rik C T 6: 13,870,542 G57E probably damaging Het
Aco1 C G 4: 40,180,284 A395G probably benign Het
Adgrf5 G A 17: 43,430,612 C380Y probably damaging Het
Astn2 T C 4: 66,059,181 T422A unknown Het
Baz1b G T 5: 135,205,062 V148F probably benign Het
Bicd1 A C 6: 149,550,356 S823R probably damaging Het
Blvra A C 2: 127,095,127 S167R probably damaging Het
Camsap2 G T 1: 136,297,394 probably null Het
Card14 T C 11: 119,337,797 S650P probably damaging Het
Cdh2 A G 18: 16,648,536 I166T probably damaging Het
Cdnf T C 2: 3,513,191 V22A probably benign Het
Chd2 T A 7: 73,429,756 K1799* probably null Het
Col20a1 G A 2: 181,016,333 probably null Het
Cyp4a31 T C 4: 115,569,746 I182T probably benign Het
Dap3 A T 3: 88,936,236 F25L probably benign Het
Dcc T A 18: 71,810,857 Y241F probably benign Het
Ddx46 A G 13: 55,666,216 I662V possibly damaging Het
Dzip3 T C 16: 48,952,136 D390G probably damaging Het
Eif1 A G 11: 100,320,798 D55G probably benign Het
Exosc5 T A 7: 25,659,365 S44T probably damaging Het
Fat2 A G 11: 55,273,171 V3086A probably damaging Het
Fcamr T A 1: 130,802,928 probably null Het
Gcg T C 2: 62,478,660 D50G probably damaging Het
Gm15448 T C 7: 3,823,127 H289R unknown Het
Gm4788 T A 1: 139,698,130 I869F probably damaging Het
Gm6588 A G 5: 112,450,127 D180G possibly damaging Het
Gm7298 A G 6: 121,786,578 probably null Het
Hfe A G 13: 23,708,192 V63A probably damaging Het
Hoxd11 T A 2: 74,683,954 I276N probably damaging Het
Htt T C 5: 34,761,943 S13P probably benign Het
Il12a T A 3: 68,691,539 C18S unknown Het
Lrrc46 A T 11: 97,040,879 L39Q probably damaging Het
Myom3 T A 4: 135,779,920 L537Q probably damaging Het
Nrap A C 19: 56,336,578 Y1234* probably null Het
Olfr635 T C 7: 103,979,536 S121P probably damaging Het
Olfr877 A T 9: 37,855,111 M98L probably benign Het
Parn T C 16: 13,541,156 D574G probably benign Het
Pbrm1 A G 14: 31,067,816 I807V probably damaging Het
Pclo T A 5: 14,675,179 S1350R unknown Het
Plaa T C 4: 94,586,349 Q272R probably damaging Het
Rfx6 T A 10: 51,718,196 I174N probably benign Het
Ripk2 T A 4: 16,139,218 K226N probably damaging Het
Scgb1b2 T C 7: 31,291,521 D54G possibly damaging Het
Slc45a4 T C 15: 73,584,534 Y599C probably benign Het
Slc7a13 T C 4: 19,819,082 V94A probably benign Het
Slc7a8 A G 14: 54,735,122 F281L probably benign Het
Slco4c1 T A 1: 96,844,536 T243S probably damaging Het
Stat5b A G 11: 100,801,436 I174T probably damaging Het
Styk1 C A 6: 131,304,885 V257L probably benign Het
Tmem268 T C 4: 63,579,972 F210L probably damaging Het
Ugt2b35 T A 5: 87,001,443 S184R probably damaging Het
Uhrf1bp1l C T 10: 89,812,066 T1330M possibly damaging Het
Vps50 T A 6: 3,562,297 L464* probably null Het
Zfhx2 A T 14: 55,064,441 S2029T probably benign Het
Zfp235 T A 7: 24,141,871 F572I probably damaging Het
Zfp280d T C 9: 72,360,333 I766T probably benign Het
Zfr T G 15: 12,171,818 C933W probably damaging Het
Other mutations in Itk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Itk APN 11 46367896 missense probably damaging 1.00
IGL01349:Itk APN 11 46341200 missense possibly damaging 0.84
IGL03290:Itk APN 11 46334937 missense probably damaging 1.00
IGL03385:Itk APN 11 46331861 nonsense probably null
Calame UTSW 11 46342395 splice site probably null
carbone UTSW 11 46331949 nonsense probably null
goodnow UTSW 11 46338099 splice site probably null
itxaro UTSW 11 46338217 missense probably damaging 1.00
BB009:Itk UTSW 11 46340692 missense probably benign
BB019:Itk UTSW 11 46340692 missense probably benign
R0095:Itk UTSW 11 46342452 missense probably damaging 0.99
R0265:Itk UTSW 11 46389458 start gained probably benign
R0281:Itk UTSW 11 46353916 missense probably damaging 1.00
R0463:Itk UTSW 11 46331989 missense probably damaging 1.00
R0518:Itk UTSW 11 46360288 missense probably damaging 0.98
R0521:Itk UTSW 11 46360288 missense probably damaging 0.98
R1121:Itk UTSW 11 46331894 missense possibly damaging 0.93
R1550:Itk UTSW 11 46389326 missense probably damaging 1.00
R1762:Itk UTSW 11 46336482 missense probably damaging 0.98
R2418:Itk UTSW 11 46338217 missense probably damaging 1.00
R2419:Itk UTSW 11 46338217 missense probably damaging 1.00
R2859:Itk UTSW 11 46344835 intron probably benign
R3107:Itk UTSW 11 46327464 missense probably benign 0.15
R3546:Itk UTSW 11 46355848 missense probably benign 0.00
R4601:Itk UTSW 11 46336515 missense probably benign 0.17
R4610:Itk UTSW 11 46336515 missense probably benign 0.17
R4792:Itk UTSW 11 46344831 intron probably benign
R4885:Itk UTSW 11 46336344 splice site probably null
R4934:Itk UTSW 11 46389325 missense probably damaging 1.00
R5286:Itk UTSW 11 46338099 splice site probably null
R5328:Itk UTSW 11 46331876 missense probably benign 0.04
R5399:Itk UTSW 11 46338111 missense probably benign 0.44
R5958:Itk UTSW 11 46344855 intron probably benign
R6235:Itk UTSW 11 46336428 missense probably benign 0.16
R6828:Itk UTSW 11 46341218 missense probably damaging 1.00
R6849:Itk UTSW 11 46331935 missense probably damaging 1.00
R7356:Itk UTSW 11 46367832 missense possibly damaging 0.72
R7753:Itk UTSW 11 46331895 missense probably damaging 1.00
R7932:Itk UTSW 11 46340692 missense probably benign
R7988:Itk UTSW 11 46355834 missense probably damaging 0.99
R8337:Itk UTSW 11 46342395 splice site probably null
R8738:Itk UTSW 11 46340712 missense probably damaging 1.00
U24488:Itk UTSW 11 46338144 missense probably damaging 1.00
X0062:Itk UTSW 11 46366044 missense probably benign 0.15
Z1088:Itk UTSW 11 46353862 splice site probably null
Predicted Primers PCR Primer
(F):5'- AACACGGACAAAGTCTGGC -3'
(R):5'- CTTCAAGAGGTCTAGAGGGGTG -3'

Sequencing Primer
(F):5'- GACAAAGTCTGGCCTGTTTATTACG -3'
(R):5'- GGGGTGGACTTAATACTCACTAC -3'
Posted On2020-07-13