Mutagenetix > Incidental Mutations

Incidental Mutation 'V1662:Cfap44'

63500

Institutional Source

Beutler Lab

Gene Symbol

Cfap44

Ensembl Gene

ENSMUSG00000071550

Gene Name

cilia and flagella associated protein 44

Synonyms

6330444M21Rik, D16Ertd642e, Wdr52

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

V1662 () of strain 633

Quality Score

Status

Not validated

Chromosome

Chromosomal Location

44394796-44482428 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to A at 44449138 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 1168 (Y1168*)

Ref Sequence

ENSEMBL: ENSMUSP00000113908 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099742] [ENSMUST00000120049]

AlphaFold

E9Q5M6

Predicted Effect

probably null
Transcript: ENSMUST00000099742
AA Change: Y1168*

SMART Domains

Protein: ENSMUSP00000097331
Gene: ENSMUSG00000071550
AA Change: Y1168*

Domain	Start	End	E-Value	Type
low complexity region	42	64	N/A	INTRINSIC
low complexity region	76	92	N/A	INTRINSIC
Blast:WD40	161	201	1e-7	BLAST
WD40	204	246	4.58e1	SMART
WD40	249	288	4.62e-1	SMART
Blast:WD40	292	337	2e-15	BLAST
WD40	342	381	4.8e-2	SMART
WD40	447	486	4.95e-4	SMART
WD40	491	532	2.64e2	SMART
WD40	552	591	2.98e-7	SMART
Blast:WD40	595	634	1e-19	BLAST
coiled coil region	669	711	N/A	INTRINSIC
WD40	780	820	3.82e1	SMART
WD40	830	872	2.4e-2	SMART
coiled coil region	907	955	N/A	INTRINSIC
coiled coil region	1101	1122	N/A	INTRINSIC
low complexity region	1266	1295	N/A	INTRINSIC
low complexity region	1312	1325	N/A	INTRINSIC
coiled coil region	1402	1459	N/A	INTRINSIC
low complexity region	1476	1488	N/A	INTRINSIC
low complexity region	1489	1523	N/A	INTRINSIC
coiled coil region	1543	1607	N/A	INTRINSIC
coiled coil region	1630	1731	N/A	INTRINSIC
coiled coil region	1795	1822	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000120049
AA Change: Y1168*

SMART Domains

Protein: ENSMUSP00000113908
Gene: ENSMUSG00000071550
AA Change: Y1168*

Domain	Start	End	E-Value	Type
low complexity region	42	64	N/A	INTRINSIC
low complexity region	76	92	N/A	INTRINSIC
Blast:WD40	161	201	1e-7	BLAST
WD40	204	246	4.58e1	SMART
WD40	249	288	4.62e-1	SMART
Blast:WD40	292	337	2e-15	BLAST
WD40	342	381	4.8e-2	SMART
WD40	447	486	4.95e-4	SMART
WD40	491	532	2.64e2	SMART
WD40	552	591	2.98e-7	SMART
Blast:WD40	595	634	1e-19	BLAST
coiled coil region	669	711	N/A	INTRINSIC
WD40	780	820	3.82e1	SMART
WD40	830	872	2.4e-2	SMART
coiled coil region	907	955	N/A	INTRINSIC
coiled coil region	1101	1122	N/A	INTRINSIC
low complexity region	1266	1295	N/A	INTRINSIC
low complexity region	1312	1325	N/A	INTRINSIC
coiled coil region	1402	1459	N/A	INTRINSIC
low complexity region	1476	1488	N/A	INTRINSIC
low complexity region	1489	1523	N/A	INTRINSIC
coiled coil region	1543	1607	N/A	INTRINSIC
coiled coil region	1630	1731	N/A	INTRINSIC
coiled coil region	1795	1822	N/A	INTRINSIC

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.3%
3x: 98.9%
10x: 97.6%
20x: 95.4%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete male sterility, asthenozoospermia, and teratozoospermia characterized by multiple sperm axonemal defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 29 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acacb	G	C	5: 114,238,708	G1951R	probably damaging	Het
Adamts12	T	A	15: 11,071,808	L146Q	probably benign	Het
Adgra1	T	C	7: 139,852,579	I111T	probably damaging	Het
Amph	G	A	13: 19,139,370	V601M	probably benign	Het
Arfgef1	T	C	1: 10,173,253	K1024E	probably damaging	Het
Arhgef2	G	A	3: 88,633,329	R154Q	probably damaging	Het
Bank1	T	A	3: 136,054,418	D782V	probably damaging	Het
Bhlha9	G	T	11: 76,673,036	R163L	probably benign	Het
Cacna1h	T	C	17: 25,377,309	N1913D	possibly damaging	Het
Cd7	T	C	11: 121,037,126	I184V	probably benign	Het
Cdk2ap1	T	A	5: 124,348,676	I68F	possibly damaging	Het
D6Ertd527e	T	C	6: 87,111,892	S346P	unknown	Het
Daam2	A	G	17: 49,464,601	L839P	possibly damaging	Het
Fam198a	A	G	9: 121,965,025	R82G	probably damaging	Het
Gm7030	A	G	17: 36,128,931	Y104H	probably benign	Het
Golgb1	A	G	16: 36,898,542	H270R	probably benign	Het
Itgav	C	T	2: 83,783,854	R519W	possibly damaging	Het
Lrp1b	A	T	2: 41,122,932	I2001K	probably damaging	Het
Lrrc40	T	A	3: 158,052,789	I277K	probably damaging	Het
Olfr1025-ps1	C	A	2: 85,918,594	T223K	probably benign	Het
Olfr1350	A	T	7: 6,570,819	Y276F	probably damaging	Het
Olfr1373	T	C	11: 52,145,177	M118V	probably damaging	Het
Olfr524	C	T	7: 140,201,958	D271N	possibly damaging	Het
Pyroxd1	G	A	6: 142,358,443	G307S	probably damaging	Het
Rp1	T	A	1: 4,349,560	Y443F	probably damaging	Het
Rpusd4	C	A	9: 35,272,761	S237R	probably benign	Het
Sdk2	A	C	11: 113,834,908	W1172G	probably damaging	Het
Utrn	A	G	10: 12,421,640	Y675H	probably damaging	Het
Vmn1r193	A	G	13: 22,219,075	I249T	possibly damaging	Het

Other mutations in Cfap44

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00236:Cfap44	APN	16	44407404	missense	probably damaging	0.99
IGL00952:Cfap44	APN	16	44421275	missense	probably benign	0.33
IGL01340:Cfap44	APN	16	44404130	missense	probably damaging	1.00
IGL01530:Cfap44	APN	16	44449167	missense	probably damaging	1.00
IGL02083:Cfap44	APN	16	44437162	missense	probably damaging	1.00
IGL02088:Cfap44	APN	16	44451628	missense	possibly damaging	0.59
IGL02142:Cfap44	APN	16	44421144	missense	probably benign	0.15
IGL02311:Cfap44	APN	16	44404771	splice site	probably benign
IGL02574:Cfap44	APN	16	44481383	missense	probably damaging	1.00
IGL02893:Cfap44	APN	16	44416817	missense	probably damaging	1.00
IGL02959:Cfap44	APN	16	44470867	splice site	probably benign
IGL03291:Cfap44	APN	16	44407311	missense	possibly damaging	0.86
feldgrau	UTSW	16	44433666	nonsense	probably null
I2288:Cfap44	UTSW	16	44449138	nonsense	probably null
R0023:Cfap44	UTSW	16	44421220	missense	probably benign	0.01
R0023:Cfap44	UTSW	16	44421220	missense	probably benign	0.01
R0036:Cfap44	UTSW	16	44439069	missense	possibly damaging	0.83
R0139:Cfap44	UTSW	16	44433422	missense	possibly damaging	0.90
R0145:Cfap44	UTSW	16	44468372	missense	probably damaging	1.00
R0193:Cfap44	UTSW	16	44449210	splice site	probably null
R0238:Cfap44	UTSW	16	44422318	missense	probably benign
R0238:Cfap44	UTSW	16	44422318	missense	probably benign
R0288:Cfap44	UTSW	16	44415894	splice site	probably benign
R0367:Cfap44	UTSW	16	44433476	critical splice donor site	probably null
R0452:Cfap44	UTSW	16	44431945	missense	probably benign	0.01
R0531:Cfap44	UTSW	16	44401426	start codon destroyed	probably benign	0.01
R0722:Cfap44	UTSW	16	44404676	missense	possibly damaging	0.94
R0801:Cfap44	UTSW	16	44422486	missense	probably benign	0.41
R1209:Cfap44	UTSW	16	44422417	missense	possibly damaging	0.86
R1215:Cfap44	UTSW	16	44419303	missense	probably damaging	1.00
R1385:Cfap44	UTSW	16	44470775	missense	probably damaging	1.00
R1400:Cfap44	UTSW	16	44421212	missense	probably benign	0.01
R1415:Cfap44	UTSW	16	44481389	missense	probably damaging	0.99
R1475:Cfap44	UTSW	16	44433812	splice site	probably benign
R1901:Cfap44	UTSW	16	44422374	missense	probably benign	0.00
R1902:Cfap44	UTSW	16	44422374	missense	probably benign	0.00
R1903:Cfap44	UTSW	16	44422374	missense	probably benign	0.00
R2023:Cfap44	UTSW	16	44416012	missense	probably benign	0.01
R2126:Cfap44	UTSW	16	44410475	missense	probably benign	0.40
R2147:Cfap44	UTSW	16	44451684	missense	probably benign	0.31
R2233:Cfap44	UTSW	16	44451525	missense	probably benign	0.01
R2439:Cfap44	UTSW	16	44481246	unclassified	probably benign
R3015:Cfap44	UTSW	16	44410469	missense	probably benign	0.40
R4178:Cfap44	UTSW	16	44451853	missense	possibly damaging	0.81
R4421:Cfap44	UTSW	16	44422437	missense	probably damaging	1.00
R4516:Cfap44	UTSW	16	44473864	nonsense	probably null
R4742:Cfap44	UTSW	16	44449252	splice site	probably null
R4766:Cfap44	UTSW	16	44415883	splice site	probably null
R4810:Cfap44	UTSW	16	44451535	missense	probably damaging	0.99
R4955:Cfap44	UTSW	16	44475277	missense	possibly damaging	0.75
R5058:Cfap44	UTSW	16	44420204	splice site	probably null
R5164:Cfap44	UTSW	16	44481389	missense	probably damaging	0.99
R5172:Cfap44	UTSW	16	44449193	missense	probably benign
R5344:Cfap44	UTSW	16	44416400	critical splice donor site	probably null
R5519:Cfap44	UTSW	16	44404088	missense	probably damaging	1.00
R5572:Cfap44	UTSW	16	44481305	missense	possibly damaging	0.95
R5601:Cfap44	UTSW	16	44460186	missense	probably damaging	1.00
R5625:Cfap44	UTSW	16	44460347	splice site	probably null
R5638:Cfap44	UTSW	16	44455531	missense	possibly damaging	0.94
R5727:Cfap44	UTSW	16	44435442	missense	probably damaging	0.98
R5950:Cfap44	UTSW	16	44479847	missense	probably damaging	0.99
R6057:Cfap44	UTSW	16	44449097	missense	probably benign	0.03
R6063:Cfap44	UTSW	16	44429892	missense	probably benign	0.00
R6221:Cfap44	UTSW	16	44437186	missense	probably benign	0.13
R6277:Cfap44	UTSW	16	44437306	missense	probably benign	0.04
R6322:Cfap44	UTSW	16	44433666	nonsense	probably null
R6836:Cfap44	UTSW	16	44404079	missense	probably damaging	0.99
R6854:Cfap44	UTSW	16	44449028	critical splice acceptor site	probably null
R6889:Cfap44	UTSW	16	44404132	missense	probably benign	0.03
R7233:Cfap44	UTSW	16	44422408	missense	probably damaging	0.99
R7294:Cfap44	UTSW	16	44404893	intron	probably benign
R7298:Cfap44	UTSW	16	44481412	missense	probably benign	0.04
R7332:Cfap44	UTSW	16	44429828	missense	probably damaging	1.00
R7410:Cfap44	UTSW	16	44468413	missense	probably damaging	1.00
R7455:Cfap44	UTSW	16	44404784	intron	probably benign
R7456:Cfap44	UTSW	16	44431942	missense	probably benign	0.07
R7491:Cfap44	UTSW	16	44470748	missense	probably damaging	1.00
R7587:Cfap44	UTSW	16	44404106	missense	probably benign	0.02
R7698:Cfap44	UTSW	16	44433786	missense	probably damaging	0.99
R7717:Cfap44	UTSW	16	44429935	missense	probably damaging	0.97
R7953:Cfap44	UTSW	16	44413691	missense	probably benign	0.00
R7994:Cfap44	UTSW	16	44432138	missense	probably damaging	0.97
R8043:Cfap44	UTSW	16	44413691	missense	probably benign	0.00
R8238:Cfap44	UTSW	16	44415305	splice site	probably null
R8338:Cfap44	UTSW	16	44419335	critical splice donor site	probably null
R8678:Cfap44	UTSW	16	44475273	missense	probably damaging	1.00
R8680:Cfap44	UTSW	16	44404722	missense	probably damaging	0.98
R8785:Cfap44	UTSW	16	44455532	missense	probably damaging	0.99
R8922:Cfap44	UTSW	16	44451667	missense	probably benign	0.23
R9005:Cfap44	UTSW	16	44460154	missense	probably damaging	1.00
R9020:Cfap44	UTSW	16	44437159	missense	probably damaging	0.99
R9110:Cfap44	UTSW	16	44435560	missense	probably damaging	0.98
R9111:Cfap44	UTSW	16	44431963	missense	probably benign	0.00
R9126:Cfap44	UTSW	16	44475256	missense	possibly damaging	0.77
R9194:Cfap44	UTSW	16	44468461	missense	probably damaging	1.00
R9251:Cfap44	UTSW	16	44408913	missense	probably damaging	0.99
R9334:Cfap44	UTSW	16	44419291	missense	probably damaging	0.98
R9336:Cfap44	UTSW	16	44422444	missense	probably damaging	0.97
X0060:Cfap44	UTSW	16	44449074	missense	possibly damaging	0.83
Z1088:Cfap44	UTSW	16	44401466	missense	probably damaging	0.98
Z1177:Cfap44	UTSW	16	44432044	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- GCGAGCATTAAGAGGCCGTTGTTAC -3'
(R):5'- CTGGTTCTGCATGGTGAGCTGATAC -3'

Sequencing Primer
(F):5'- AAGAGGCCGTTGTTACATTTATGTC -3'
(R):5'- ACAGGATGCTTTTCGTGGTC -3'

Posted On

2013-07-30