Incidental Mutation 'R8189:Serpinb3c'
ID 635007
Institutional Source Beutler Lab
Gene Symbol Serpinb3c
Ensembl Gene ENSMUSG00000073601
Gene Name serine (or cysteine) peptidase inhibitor, clade B, member 3C
Synonyms ovalbumin, Serpinb4, 1110013A16Rik, 1110001H02Rik, Scca2
MMRRC Submission 067612-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.087) question?
Stock # R8189 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 107198931-107206101 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 107204039 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 58 (C58S)
Ref Sequence ENSEMBL: ENSMUSP00000027565 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027565] [ENSMUST00000166100]
AlphaFold A2RSF9
Predicted Effect probably benign
Transcript: ENSMUST00000027565
AA Change: C58S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000027565
Gene: ENSMUSG00000073601
AA Change: C58S

DomainStartEndE-ValueType
SERPIN 13 386 7.91e-169 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166100
SMART Domains Protein: ENSMUSP00000132370
Gene: ENSMUSG00000073602

DomainStartEndE-ValueType
SERPIN 13 387 4.75e-181 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (42/42)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A G 1: 71,324,885 (GRCm39) I1531T probably damaging Het
Ankrd13d G A 19: 4,320,880 (GRCm39) P516S probably benign Het
Bag6 A G 17: 35,364,214 (GRCm39) probably null Het
Cchcr1 A G 17: 35,837,563 (GRCm39) I422V probably benign Het
Ceacam1 A G 7: 25,173,343 (GRCm39) S282P probably damaging Het
Chka G T 19: 3,925,759 (GRCm39) E159* probably null Het
Ckmt2 T C 13: 92,003,894 (GRCm39) Y368C probably damaging Het
Cngb1 TTCTGGCTCTGGCTCTGGCTCTGGCTCTGGCTCTGGCTCTGGCTCTGGCTCTGGCTCTGGCTCTGGCTCTGG TTCTGGCTCTGGCTCTGGCTCTGG 8: 96,030,248 (GRCm39) probably benign Het
Ctsq A G 13: 61,184,969 (GRCm39) L239P probably damaging Het
D630045J12Rik A G 6: 38,135,106 (GRCm39) L1358P probably damaging Het
Dglucy G A 12: 100,804,889 (GRCm39) E127K probably benign Het
Dnajb8 C T 6: 88,199,940 (GRCm39) R159C possibly damaging Het
Fgd6 T C 10: 93,910,077 (GRCm39) L794P probably benign Het
Fgfr2 G A 7: 129,774,629 (GRCm39) T654I probably damaging Het
Gmeb2 G A 2: 180,919,760 (GRCm39) T38M probably damaging Het
Gria1 T C 11: 57,108,625 (GRCm39) F243L probably benign Het
Gria2 A T 3: 80,629,489 (GRCm39) D244E probably damaging Het
Ints2 T A 11: 86,106,396 (GRCm39) I1005F probably damaging Het
Ipo11 T A 13: 107,061,604 (GRCm39) S19C probably damaging Het
Kmt2b A G 7: 30,268,756 (GRCm39) F2658L probably damaging Het
Lrrc38 G A 4: 143,077,303 (GRCm39) G189R probably damaging Het
Mcf2l A G 8: 13,013,164 (GRCm39) D27G probably damaging Het
Mrgprb2 G T 7: 48,202,502 (GRCm39) Y74* probably null Het
Mtrex T A 13: 113,028,515 (GRCm39) R628S possibly damaging Het
Nrcam C A 12: 44,617,291 (GRCm39) P740T possibly damaging Het
Nrxn1 C T 17: 91,011,637 (GRCm39) V331I probably damaging Het
Or2a57 T C 6: 43,213,013 (GRCm39) V157A probably benign Het
Or4f17-ps1 T C 2: 111,358,118 (GRCm39) V153A Het
Or5k1b T A 16: 58,581,288 (GRCm39) N84Y probably damaging Het
Or5p52 A G 7: 107,501,939 (GRCm39) N5S probably damaging Het
Or6c66b T A 10: 129,377,122 (GRCm39) C239S probably damaging Het
Pla2g4a A G 1: 149,733,337 (GRCm39) F479L probably benign Het
Pramel20 T G 4: 143,298,530 (GRCm39) Y158D probably benign Het
Scaper A T 9: 55,819,404 (GRCm39) F104I probably damaging Het
Setdb1 A G 3: 95,254,022 (GRCm39) V260A probably damaging Het
Shank3 A G 15: 89,433,439 (GRCm39) T1395A probably benign Het
Slc35b4 A G 6: 34,144,570 (GRCm39) I95T probably damaging Het
Trpm5 A G 7: 142,635,575 (GRCm39) V599A probably benign Het
Ttk A G 9: 83,729,272 (GRCm39) S352G probably benign Het
Ugt2b35 T A 5: 87,149,302 (GRCm39) S184R probably damaging Het
Usp17le C T 7: 104,418,555 (GRCm39) D196N probably damaging Het
Vmn2r15 A G 5: 109,434,713 (GRCm39) F664L probably benign Het
Vmn2r94 A T 17: 18,478,618 (GRCm39) L43Q probably damaging Het
Other mutations in Serpinb3c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00847:Serpinb3c APN 1 107,203,990 (GRCm39) critical splice donor site probably null
IGL01349:Serpinb3c APN 1 107,200,513 (GRCm39) missense probably damaging 1.00
IGL01730:Serpinb3c APN 1 107,200,914 (GRCm39) missense probably damaging 0.99
IGL01732:Serpinb3c APN 1 107,199,702 (GRCm39) missense probably benign
IGL02184:Serpinb3c APN 1 107,199,648 (GRCm39) missense probably damaging 0.96
IGL02742:Serpinb3c APN 1 107,200,872 (GRCm39) nonsense probably null
IGL03131:Serpinb3c APN 1 107,199,457 (GRCm39) missense probably benign 0.09
IGL03394:Serpinb3c APN 1 107,199,603 (GRCm39) missense probably benign 0.00
BB001:Serpinb3c UTSW 1 107,200,904 (GRCm39) missense probably damaging 1.00
BB011:Serpinb3c UTSW 1 107,200,904 (GRCm39) missense probably damaging 1.00
R0207:Serpinb3c UTSW 1 107,204,722 (GRCm39) missense probably benign 0.02
R0508:Serpinb3c UTSW 1 107,204,651 (GRCm39) missense probably damaging 1.00
R1542:Serpinb3c UTSW 1 107,200,517 (GRCm39) missense probably damaging 1.00
R1660:Serpinb3c UTSW 1 107,199,432 (GRCm39) missense probably damaging 1.00
R1731:Serpinb3c UTSW 1 107,199,504 (GRCm39) missense probably damaging 0.99
R2012:Serpinb3c UTSW 1 107,199,574 (GRCm39) missense possibly damaging 0.92
R5361:Serpinb3c UTSW 1 107,204,661 (GRCm39) nonsense probably null
R5464:Serpinb3c UTSW 1 107,199,434 (GRCm39) missense probably damaging 0.99
R5636:Serpinb3c UTSW 1 107,202,744 (GRCm39) missense possibly damaging 0.57
R5677:Serpinb3c UTSW 1 107,199,533 (GRCm39) missense probably damaging 1.00
R5965:Serpinb3c UTSW 1 107,204,653 (GRCm39) missense probably benign 0.01
R6424:Serpinb3c UTSW 1 107,199,359 (GRCm39) makesense probably null
R7132:Serpinb3c UTSW 1 107,204,681 (GRCm39) missense probably damaging 0.96
R7161:Serpinb3c UTSW 1 107,200,892 (GRCm39) missense probably null 1.00
R7319:Serpinb3c UTSW 1 107,200,817 (GRCm39) missense possibly damaging 0.92
R7437:Serpinb3c UTSW 1 107,199,444 (GRCm39) missense probably damaging 1.00
R7871:Serpinb3c UTSW 1 107,200,883 (GRCm39) missense possibly damaging 0.95
R7922:Serpinb3c UTSW 1 107,199,744 (GRCm39) missense probably damaging 1.00
R7924:Serpinb3c UTSW 1 107,200,904 (GRCm39) missense probably damaging 1.00
R8114:Serpinb3c UTSW 1 107,204,034 (GRCm39) missense probably benign 0.03
R8384:Serpinb3c UTSW 1 107,199,697 (GRCm39) missense probably benign 0.02
R9042:Serpinb3c UTSW 1 107,199,731 (GRCm39) missense probably damaging 1.00
R9518:Serpinb3c UTSW 1 107,200,468 (GRCm39) missense probably damaging 0.99
R9566:Serpinb3c UTSW 1 107,200,425 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCAGGGCAGAGCTTTGGTC -3'
(R):5'- GCACTGAGAGAATGGGCATC -3'

Sequencing Primer
(F):5'- CCTACCTGTGAGGGTTAGAGC -3'
(R):5'- CACTGAGAGAATGGGCATCTATTTG -3'
Posted On 2020-07-13