Mutagenetix > Incidental Mutation

Incidental Mutation 'V1662:Cacna1h'

63502

Institutional Source

Beutler Lab

Gene Symbol

Cacna1h

Ensembl Gene

ENSMUSG00000024112

Gene Name

calcium channel, voltage-dependent, T type, alpha 1H subunit

Synonyms

Cav3.2, alpha13.2, T-type Cav3.2

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

V1662 () of strain 633

Quality Score

131

Status

Not validated

Chromosome

Chromosomal Location

25374285-25433783 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 25377309 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Aspartic acid at position 1913 (N1913D)

Ref Sequence

ENSEMBL: ENSMUSP00000125541 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024999] [ENSMUST00000078496] [ENSMUST00000159048] [ENSMUST00000159610] [ENSMUST00000160377] [ENSMUST00000160485] [ENSMUST00000160920] [ENSMUST00000162021]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000024999

SMART Domains

Protein: ENSMUSP00000024999
Gene: ENSMUSG00000033200

Domain	Start	End	E-Value	Type
Tryp_SPc	29	257	1.06e-87	SMART
transmembrane domain	274	296	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000078496
AA Change: N1913D

PolyPhen 2 Score 0.676 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000077586
Gene: ENSMUSG00000024112
AA Change: N1913D

Domain	Start	End	E-Value	Type
low complexity region	16	36	N/A	INTRINSIC
Pfam:Ion_trans	138	418	8.4e-65	PFAM
low complexity region	500	511	N/A	INTRINSIC
low complexity region	515	531	N/A	INTRINSIC
low complexity region	557	568	N/A	INTRINSIC
low complexity region	708	723	N/A	INTRINSIC
Pfam:Ion_trans	824	1011	4.7e-46	PFAM
low complexity region	1130	1147	N/A	INTRINSIC
low complexity region	1248	1259	N/A	INTRINSIC
Pfam:Ion_trans	1341	1565	4.5e-56	PFAM
low complexity region	1576	1602	N/A	INTRINSIC
Pfam:Ion_trans	1656	1864	7.8e-48	PFAM
Pfam:PKD_channel	1714	1871	1.2e-10	PFAM
Blast:Tryp_SPc	1915	2077	1e-38	BLAST
low complexity region	2086	2097	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000159048
AA Change: N1807D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000123741
Gene: ENSMUSG00000024112
AA Change: N1807D

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	32	312	8e-65	PFAM
low complexity region	394	405	N/A	INTRINSIC
low complexity region	409	425	N/A	INTRINSIC
low complexity region	451	462	N/A	INTRINSIC
low complexity region	602	617	N/A	INTRINSIC
Pfam:Ion_trans	718	905	4.6e-46	PFAM
low complexity region	1024	1041	N/A	INTRINSIC
low complexity region	1142	1153	N/A	INTRINSIC
Pfam:Ion_trans	1235	1459	4.3e-56	PFAM
low complexity region	1470	1496	N/A	INTRINSIC
Pfam:PKD_channel	1524	1608	1.6e-6	PFAM
Pfam:Ion_trans	1550	1758	7.6e-48	PFAM
Pfam:PKD_channel	1609	1765	1.2e-10	PFAM
Blast:Tryp_SPc	1809	1854	9e-6	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159331

Predicted Effect

possibly damaging
Transcript: ENSMUST00000159610
AA Change: N1913D

PolyPhen 2 Score 0.676 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000125541
Gene: ENSMUSG00000024112
AA Change: N1913D

Domain	Start	End	E-Value	Type
low complexity region	16	36	N/A	INTRINSIC
Pfam:Ion_trans	99	430	7e-79	PFAM
low complexity region	500	511	N/A	INTRINSIC
low complexity region	515	531	N/A	INTRINSIC
low complexity region	557	568	N/A	INTRINSIC
low complexity region	708	723	N/A	INTRINSIC
Pfam:Ion_trans	789	1023	2.4e-58	PFAM
low complexity region	1130	1147	N/A	INTRINSIC
low complexity region	1248	1259	N/A	INTRINSIC
Pfam:Ion_trans	1304	1577	4.5e-65	PFAM
Pfam:Ion_trans	1621	1876	4.2e-59	PFAM
Pfam:PKD_channel	1629	1715	9.3e-7	PFAM
Pfam:PKD_channel	1713	1871	2.2e-11	PFAM
Blast:Tryp_SPc	1915	2077	1e-38	BLAST
low complexity region	2086	2097	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000160377

SMART Domains

Protein: ENSMUSP00000124008
Gene: ENSMUSG00000033200

Domain	Start	End	E-Value	Type
Tryp_SPc	4	154	1.79e-30	SMART
transmembrane domain	171	193	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000160485

SMART Domains

Protein: ENSMUSP00000124721
Gene: ENSMUSG00000033200

Domain	Start	End	E-Value	Type
Tryp_SPc	4	154	1.79e-30	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000160920

SMART Domains

Protein: ENSMUSP00000123828
Gene: ENSMUSG00000033200

Domain	Start	End	E-Value	Type
Tryp_SPc	1	184	7.18e-44	SMART
transmembrane domain	201	223	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000161035
AA Change: N206D

SMART Domains

Protein: ENSMUSP00000123906
Gene: ENSMUSG00000024112
AA Change: N206D

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	1	73	2.1e-9	PFAM
Pfam:Ion_trans	72	170	2.8e-17	PFAM
Blast:Tryp_SPc	209	291	3e-13	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000161658

Predicted Effect

probably benign
Transcript: ENSMUST00000162021

SMART Domains

Protein: ENSMUSP00000125180
Gene: ENSMUSG00000033200

Domain	Start	End	E-Value	Type
Tryp_SPc	5	111	2.35e-4	SMART
transmembrane domain	128	150	N/A	INTRINSIC

Coding Region Coverage

1x: 99.3%
3x: 98.9%
10x: 97.6%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: Voltage-dependent Ca(2+) channels mediate the entry of Ca(2+) ions into excitable cells and are involved in a variety of Ca(2+)-dependent processes, including muscle contraction, hormone or neurotransmitter release, and gene expression. The protein encoded by this gene is an integral membrane protein that belongs to the calcium channel alpha-1 subunits family. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2009]
PHENOTYPE: Mutation of this locus results in constitutive coronary arteriole contraction and focal myocardial fibrosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 29 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acacb	G	C	5: 114,238,708	G1951R	probably damaging	Het
Adamts12	T	A	15: 11,071,808	L146Q	probably benign	Het
Adgra1	T	C	7: 139,852,579	I111T	probably damaging	Het
Amph	G	A	13: 19,139,370	V601M	probably benign	Het
Arfgef1	T	C	1: 10,173,253	K1024E	probably damaging	Het
Arhgef2	G	A	3: 88,633,329	R154Q	probably damaging	Het
Bank1	T	A	3: 136,054,418	D782V	probably damaging	Het
Bhlha9	G	T	11: 76,673,036	R163L	probably benign	Het
Cd7	T	C	11: 121,037,126	I184V	probably benign	Het
Cdk2ap1	T	A	5: 124,348,676	I68F	possibly damaging	Het
Cfap44	C	A	16: 44,449,138	Y1168*	probably null	Het
D6Ertd527e	T	C	6: 87,111,892	S346P	unknown	Het
Daam2	A	G	17: 49,464,601	L839P	possibly damaging	Het
Fam198a	A	G	9: 121,965,025	R82G	probably damaging	Het
Gm7030	A	G	17: 36,128,931	Y104H	probably benign	Het
Golgb1	A	G	16: 36,898,542	H270R	probably benign	Het
Itgav	C	T	2: 83,783,854	R519W	possibly damaging	Het
Lrp1b	A	T	2: 41,122,932	I2001K	probably damaging	Het
Lrrc40	T	A	3: 158,052,789	I277K	probably damaging	Het
Olfr1025-ps1	C	A	2: 85,918,594	T223K	probably benign	Het
Olfr1350	A	T	7: 6,570,819	Y276F	probably damaging	Het
Olfr1373	T	C	11: 52,145,177	M118V	probably damaging	Het
Olfr524	C	T	7: 140,201,958	D271N	possibly damaging	Het
Pyroxd1	G	A	6: 142,358,443	G307S	probably damaging	Het
Rp1	T	A	1: 4,349,560	Y443F	probably damaging	Het
Rpusd4	C	A	9: 35,272,761	S237R	probably benign	Het
Sdk2	A	C	11: 113,834,908	W1172G	probably damaging	Het
Utrn	A	G	10: 12,421,640	Y675H	probably damaging	Het
Vmn1r193	A	G	13: 22,219,075	I249T	possibly damaging	Het

Other mutations in Cacna1h

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00505:Cacna1h	APN	17	25381508	missense	probably damaging	1.00
IGL01412:Cacna1h	APN	17	25391950	missense	probably benign	0.24
IGL01625:Cacna1h	APN	17	25383485	missense	probably damaging	0.97
IGL01625:Cacna1h	APN	17	25385712	missense	possibly damaging	0.95
IGL01684:Cacna1h	APN	17	25388716	missense	probably damaging	1.00
IGL01862:Cacna1h	APN	17	25383483	missense	probably damaging	1.00
IGL01877:Cacna1h	APN	17	25388050	missense	probably damaging	1.00
IGL02040:Cacna1h	APN	17	25397611	missense	probably benign	0.10
IGL02190:Cacna1h	APN	17	25433026	missense	probably benign
IGL02686:Cacna1h	APN	17	25385749	missense	possibly damaging	0.80
IGL02883:Cacna1h	APN	17	25380532	missense	probably damaging	1.00
IGL02945:Cacna1h	APN	17	25388059	missense	probably damaging	1.00
IGL03025:Cacna1h	APN	17	25432894	nonsense	probably null
IGL03095:Cacna1h	APN	17	25383778	unclassified	probably benign
IGL03207:Cacna1h	APN	17	25391333	missense	probably damaging	1.00
IGL02991:Cacna1h	UTSW	17	25391312	missense	possibly damaging	0.56
IGL03097:Cacna1h	UTSW	17	25391144	missense	probably damaging	1.00
R0010:Cacna1h	UTSW	17	25380844	missense	probably damaging	1.00
R0194:Cacna1h	UTSW	17	25380924	unclassified	probably benign
R0361:Cacna1h	UTSW	17	25389422	missense	probably damaging	1.00
R0501:Cacna1h	UTSW	17	25388667	missense	probably damaging	1.00
R0558:Cacna1h	UTSW	17	25381550	missense	probably damaging	1.00
R0588:Cacna1h	UTSW	17	25387564	missense	probably damaging	1.00
R0626:Cacna1h	UTSW	17	25393546	missense	possibly damaging	0.92
R0811:Cacna1h	UTSW	17	25388628	missense	probably damaging	1.00
R0812:Cacna1h	UTSW	17	25388628	missense	probably damaging	1.00
R0964:Cacna1h	UTSW	17	25378775	unclassified	probably benign
R1351:Cacna1h	UTSW	17	25391951	missense	probably benign	0.14
R1457:Cacna1h	UTSW	17	25397620	missense	probably damaging	1.00
R1521:Cacna1h	UTSW	17	25397354	missense	possibly damaging	0.57
R1564:Cacna1h	UTSW	17	25377861	nonsense	probably null
R1611:Cacna1h	UTSW	17	25381471	missense	probably damaging	1.00
R1669:Cacna1h	UTSW	17	25383471	missense	probably damaging	1.00
R1835:Cacna1h	UTSW	17	25392076	missense	probably benign	0.01
R1858:Cacna1h	UTSW	17	25380807	missense	probably damaging	1.00
R1887:Cacna1h	UTSW	17	25376887	missense	probably benign	0.01
R2039:Cacna1h	UTSW	17	25391845	missense	probably benign	0.03
R2091:Cacna1h	UTSW	17	25432876	missense	possibly damaging	0.95
R2133:Cacna1h	UTSW	17	25383528	missense	probably damaging	1.00
R2203:Cacna1h	UTSW	17	25380260	missense	probably damaging	1.00
R2205:Cacna1h	UTSW	17	25380260	missense	probably damaging	1.00
R2206:Cacna1h	UTSW	17	25385013	missense	probably benign	0.10
R2207:Cacna1h	UTSW	17	25385013	missense	probably benign	0.10
R2224:Cacna1h	UTSW	17	25385943	missense	probably benign	0.03
R2226:Cacna1h	UTSW	17	25385943	missense	probably benign	0.03
R2261:Cacna1h	UTSW	17	25433165	missense	possibly damaging	0.91
R2361:Cacna1h	UTSW	17	25384012	missense	probably damaging	1.00
R2917:Cacna1h	UTSW	17	25395452	missense	probably damaging	0.97
R3031:Cacna1h	UTSW	17	25433134	missense	probably damaging	0.99
R3856:Cacna1h	UTSW	17	25392453	missense	probably damaging	1.00
R4230:Cacna1h	UTSW	17	25387863	missense	probably damaging	1.00
R4408:Cacna1h	UTSW	17	25380627	missense	probably damaging	1.00
R4687:Cacna1h	UTSW	17	25393910	missense	possibly damaging	0.47
R4887:Cacna1h	UTSW	17	25377287	missense	possibly damaging	0.86
R4895:Cacna1h	UTSW	17	25389422	missense	probably damaging	0.99
R5067:Cacna1h	UTSW	17	25397808	missense	probably damaging	1.00
R5077:Cacna1h	UTSW	17	25375250	missense	probably benign	0.02
R5148:Cacna1h	UTSW	17	25387545	missense	probably damaging	1.00
R5336:Cacna1h	UTSW	17	25392231	missense	probably damaging	0.99
R5450:Cacna1h	UTSW	17	25383186	missense	probably damaging	1.00
R5616:Cacna1h	UTSW	17	25377667	missense	probably damaging	1.00
R5738:Cacna1h	UTSW	17	25387049	missense	probably damaging	0.99
R5883:Cacna1h	UTSW	17	25376922	missense	probably benign	0.00
R5954:Cacna1h	UTSW	17	25383201	missense	probably damaging	1.00
R5961:Cacna1h	UTSW	17	25377272	missense	probably benign	0.01
R6110:Cacna1h	UTSW	17	25391276	missense	probably benign	0.10
R6125:Cacna1h	UTSW	17	25385694	missense	probably benign	0.00
R6189:Cacna1h	UTSW	17	25397844	missense	probably damaging	1.00
R6216:Cacna1h	UTSW	17	25378819	missense	probably damaging	1.00
R6259:Cacna1h	UTSW	17	25397656	critical splice acceptor site	probably null
R6296:Cacna1h	UTSW	17	25383079	missense	probably damaging	1.00
R6394:Cacna1h	UTSW	17	25387481	missense	probably benign	0.32
R6695:Cacna1h	UTSW	17	25393740	missense	probably damaging	1.00
R6746:Cacna1h	UTSW	17	25381550	missense	probably damaging	1.00
R6914:Cacna1h	UTSW	17	25385039	missense	probably benign
R6942:Cacna1h	UTSW	17	25385039	missense	probably benign
R6955:Cacna1h	UTSW	17	25388056	missense	probably damaging	1.00
R7041:Cacna1h	UTSW	17	25394003	missense	probably damaging	0.98
R7120:Cacna1h	UTSW	17	25391507	missense	probably benign	0.31
R7125:Cacna1h	UTSW	17	25383536	missense	probably damaging	0.99
R7182:Cacna1h	UTSW	17	25377655	missense	probably damaging	1.00
R7270:Cacna1h	UTSW	17	25384765	missense	probably damaging	1.00
R7274:Cacna1h	UTSW	17	25378837	missense	probably damaging	1.00
R7319:Cacna1h	UTSW	17	25389461	missense	possibly damaging	0.94
R7406:Cacna1h	UTSW	17	25385626	missense	possibly damaging	0.56
R7634:Cacna1h	UTSW	17	25392109	missense	possibly damaging	0.87
R7684:Cacna1h	UTSW	17	25389372	missense	probably damaging	0.99
R7769:Cacna1h	UTSW	17	25385805	missense	probably damaging	1.00
R7856:Cacna1h	UTSW	17	25389477	missense	probably damaging	0.98
R7876:Cacna1h	UTSW	17	25375251	missense	probably benign
R7898:Cacna1h	UTSW	17	25392276	missense	probably damaging	1.00
R8038:Cacna1h	UTSW	17	25375891	missense	probably damaging	0.97
R8042:Cacna1h	UTSW	17	25392471	nonsense	probably null
R8139:Cacna1h	UTSW	17	25383723	missense	probably damaging	1.00
R8391:Cacna1h	UTSW	17	25377230	missense	probably benign	0.00
R8795:Cacna1h	UTSW	17	25393564	missense	probably damaging	1.00
R9227:Cacna1h	UTSW	17	25380882	missense	probably damaging	1.00
R9230:Cacna1h	UTSW	17	25380882	missense	probably damaging	1.00
R9236:Cacna1h	UTSW	17	25381450	missense	probably damaging	1.00
R9360:Cacna1h	UTSW	17	25375362	missense	probably benign	0.00
R9476:Cacna1h	UTSW	17	25392550	missense	probably damaging	1.00
R9567:Cacna1h	UTSW	17	25393513	missense	probably damaging	1.00
R9696:Cacna1h	UTSW	17	25383241	missense	possibly damaging	0.90
Z1176:Cacna1h	UTSW	17	25391250	missense	probably benign
Z1177:Cacna1h	UTSW	17	25375892	missense	probably damaging	1.00
Z1177:Cacna1h	UTSW	17	25391378	missense	probably damaging	0.99
Z1177:Cacna1h	UTSW	17	25393584	missense	probably benign	0.15

Predicted Primers

PCR Primer
(F):5'- ACACCCGAAGAGATGCTACCTGTG -3'
(R):5'- CCGTGAATGTACCCGTGAAGACAAG -3'

Sequencing Primer
(F):5'- TGTGTAGGTCTCCATCTCCAC -3'
(R):5'- TGCTCATGAAGCACCTGGAG -3'

Posted On

2013-07-30