Incidental Mutation 'V1662:Gm7030'
ID 63503
Institutional Source Beutler Lab
Gene Symbol Gm7030
Ensembl Gene ENSMUSG00000092243
Gene Name predicted gene 7030
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.178) question?
Stock # V1662 () of strain 633
Quality Score 114
Status Not validated
Chromosome 17
Chromosomal Location 36109719-36129425 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 36128931 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 104 (Y104H)
Ref Sequence ENSEMBL: ENSMUSP00000133734 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046131] [ENSMUST00000172968] [ENSMUST00000173128] [ENSMUST00000173322]
AlphaFold Q0WXH6
Predicted Effect probably benign
Transcript: ENSMUST00000046131
AA Change: Y104H

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000040558
Gene: ENSMUSG00000092243
AA Change: Y104H

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:MHC_I 26 204 2.3e-81 PFAM
IGc1 220 285 8.12e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172968
AA Change: Y104H

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000133748
Gene: ENSMUSG00000092243
AA Change: Y104H

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:MHC_I 26 204 1.5e-80 PFAM
IGc1 220 285 8.12e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173128
SMART Domains Protein: ENSMUSP00000134339
Gene: ENSMUSG00000092277

DomainStartEndE-ValueType
low complexity region 103 115 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173322
AA Change: Y104H

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000133734
Gene: ENSMUSG00000092243
AA Change: Y104H

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:MHC_I 26 204 2.3e-81 PFAM
IGc1 220 285 8.12e-13 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb G C 5: 114,238,708 G1951R probably damaging Het
Adamts12 T A 15: 11,071,808 L146Q probably benign Het
Adgra1 T C 7: 139,852,579 I111T probably damaging Het
Amph G A 13: 19,139,370 V601M probably benign Het
Arfgef1 T C 1: 10,173,253 K1024E probably damaging Het
Arhgef2 G A 3: 88,633,329 R154Q probably damaging Het
Bank1 T A 3: 136,054,418 D782V probably damaging Het
Bhlha9 G T 11: 76,673,036 R163L probably benign Het
Cacna1h T C 17: 25,377,309 N1913D possibly damaging Het
Cd7 T C 11: 121,037,126 I184V probably benign Het
Cdk2ap1 T A 5: 124,348,676 I68F possibly damaging Het
Cfap44 C A 16: 44,449,138 Y1168* probably null Het
D6Ertd527e T C 6: 87,111,892 S346P unknown Het
Daam2 A G 17: 49,464,601 L839P possibly damaging Het
Fam198a A G 9: 121,965,025 R82G probably damaging Het
Golgb1 A G 16: 36,898,542 H270R probably benign Het
Itgav C T 2: 83,783,854 R519W possibly damaging Het
Lrp1b A T 2: 41,122,932 I2001K probably damaging Het
Lrrc40 T A 3: 158,052,789 I277K probably damaging Het
Olfr1025-ps1 C A 2: 85,918,594 T223K probably benign Het
Olfr1350 A T 7: 6,570,819 Y276F probably damaging Het
Olfr1373 T C 11: 52,145,177 M118V probably damaging Het
Olfr524 C T 7: 140,201,958 D271N possibly damaging Het
Pyroxd1 G A 6: 142,358,443 G307S probably damaging Het
Rp1 T A 1: 4,349,560 Y443F probably damaging Het
Rpusd4 C A 9: 35,272,761 S237R probably benign Het
Sdk2 A C 11: 113,834,908 W1172G probably damaging Het
Utrn A G 10: 12,421,640 Y675H probably damaging Het
Vmn1r193 A G 13: 22,219,075 I249T possibly damaging Het
Other mutations in Gm7030
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02997:Gm7030 APN 17 36127836 missense possibly damaging 0.81
IGL03154:Gm7030 APN 17 36127875 missense probably benign 0.01
IGL03170:Gm7030 APN 17 36128713 missense probably damaging 1.00
IGL03229:Gm7030 APN 17 36127722 missense probably damaging 1.00
R0401:Gm7030 UTSW 17 36128705 missense probably damaging 0.99
R0666:Gm7030 UTSW 17 36127834 missense possibly damaging 0.56
R1981:Gm7030 UTSW 17 36128722 missense probably damaging 0.99
R1982:Gm7030 UTSW 17 36128722 missense probably damaging 0.99
R3110:Gm7030 UTSW 17 36129146 missense probably damaging 1.00
R3112:Gm7030 UTSW 17 36129146 missense probably damaging 1.00
R4811:Gm7030 UTSW 17 36127776 missense probably damaging 0.97
R5023:Gm7030 UTSW 17 36109415 unclassified probably benign
R5146:Gm7030 UTSW 17 36129015 missense probably damaging 1.00
R5802:Gm7030 UTSW 17 36111287 intron probably benign
R6628:Gm7030 UTSW 17 36129054 missense possibly damaging 0.49
R7123:Gm7030 UTSW 17 36127794 missense possibly damaging 0.82
R7244:Gm7030 UTSW 17 36127604 splice site probably null
R7880:Gm7030 UTSW 17 36127869 missense possibly damaging 0.59
R8118:Gm7030 UTSW 17 36127690 missense probably damaging 0.97
R8926:Gm7030 UTSW 17 36109734 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TCCCACGTAGCATCCGTGCATATC -3'
(R):5'- ATTTCGCCACTGCCATGTCCAG -3'

Sequencing Primer
(F):5'- CATCCGTGCATATCCTGGATAG -3'
(R):5'- ATGTCCAGGCCAGGCTTAG -3'
Posted On 2013-07-30