Incidental Mutation 'R8189:Ints2'
ID635035
Institutional Source Beutler Lab
Gene Symbol Ints2
Ensembl Gene ENSMUSG00000018068
Gene Nameintegrator complex subunit 2
Synonyms2810417D08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8189 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location86210681-86257575 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 86215570 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 1005 (I1005F)
Ref Sequence ENSEMBL: ENSMUSP00000018212 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018212] [ENSMUST00000108039]
Predicted Effect probably damaging
Transcript: ENSMUST00000018212
AA Change: I1005F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000018212
Gene: ENSMUSG00000018068
AA Change: I1005F

DomainStartEndE-ValueType
Pfam:INTS2 24 1131 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108039
AA Change: I1005F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103674
Gene: ENSMUSG00000018068
AA Change: I1005F

DomainStartEndE-ValueType
Pfam:INTS2 24 1132 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134828
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] INTS2 is a subunit of the Integrator complex, which associates with the C-terminal domain of RNA polymerase II large subunit (POLR2A; MIM 180660) and mediates 3-prime end processing of small nuclear RNAs U1 (RNU1; MIM 180680) and U2 (RNU2; MIM 180690) (Baillat et al., 2005 [PubMed 16239144]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030617O03Rik G A 12: 100,838,630 E127K probably benign Het
Abca12 A G 1: 71,285,726 I1531T probably damaging Het
Ankrd13d G A 19: 4,270,852 P516S probably benign Het
Bag6 A G 17: 35,145,238 probably null Het
BC080695 T G 4: 143,571,960 Y158D probably benign Het
Cchcr1 A G 17: 35,526,666 I422V probably benign Het
Ceacam1 A G 7: 25,473,918 S282P probably damaging Het
Chka G T 19: 3,875,759 E159* probably null Het
Ckmt2 T C 13: 91,855,775 Y368C probably damaging Het
Cngb1 TTCTGGCTCTGGCTCTGGCTCTGGCTCTGGCTCTGGCTCTGGCTCTGGCTCTGGCTCTGGCTCTGGCTCTGG TTCTGGCTCTGGCTCTGGCTCTGG 8: 95,303,620 probably benign Het
Ctsq A G 13: 61,037,155 L239P probably damaging Het
D630045J12Rik A G 6: 38,158,171 L1358P probably damaging Het
Dnajb8 C T 6: 88,222,958 R159C possibly damaging Het
Fgd6 T C 10: 94,074,215 L794P probably benign Het
Fgfr2 G A 7: 130,172,899 T654I probably damaging Het
Gmeb2 G A 2: 181,277,967 T38M probably damaging Het
Gria1 T C 11: 57,217,799 F243L probably benign Het
Gria2 A T 3: 80,722,182 D244E probably damaging Het
Ipo11 T A 13: 106,925,096 S19C probably damaging Het
Kmt2b A G 7: 30,569,331 F2658L probably damaging Het
Lrrc38 G A 4: 143,350,733 G189R probably damaging Het
Mcf2l A G 8: 12,963,164 D27G probably damaging Het
Mrgprb2 G T 7: 48,552,754 Y74* probably null Het
Nrcam C A 12: 44,570,508 P740T possibly damaging Het
Nrxn1 C T 17: 90,704,209 V331I probably damaging Het
Olfr1293-ps T C 2: 111,527,773 V153A Het
Olfr172 T A 16: 58,760,925 N84Y probably damaging Het
Olfr47 T C 6: 43,236,079 V157A probably benign Het
Olfr472 A G 7: 107,902,732 N5S probably damaging Het
Olfr792 T A 10: 129,541,253 C239S probably damaging Het
Pla2g4a A G 1: 149,857,586 F479L probably benign Het
Scaper A T 9: 55,912,120 F104I probably damaging Het
Serpinb3c A T 1: 107,276,309 C58S probably benign Het
Setdb1 A G 3: 95,346,711 V260A probably damaging Het
Shank3 A G 15: 89,549,236 T1395A probably benign Het
Skiv2l2 T A 13: 112,891,981 R628S possibly damaging Het
Slc35b4 A G 6: 34,167,635 I95T probably damaging Het
Trpm5 A G 7: 143,081,838 V599A probably benign Het
Ttk A G 9: 83,847,219 S352G probably benign Het
Ugt2b35 T A 5: 87,001,443 S184R probably damaging Het
Usp17le C T 7: 104,769,348 D196N probably damaging Het
Vmn2r15 A G 5: 109,286,847 F664L probably benign Het
Vmn2r94 A T 17: 18,258,356 L43Q probably damaging Het
Other mutations in Ints2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00807:Ints2 APN 11 86233135 missense probably damaging 1.00
IGL02490:Ints2 APN 11 86233183 missense possibly damaging 0.93
IGL02612:Ints2 APN 11 86215578 missense probably damaging 1.00
IGL03396:Ints2 APN 11 86213062 missense probably damaging 0.99
R0015:Ints2 UTSW 11 86249287 missense probably damaging 1.00
R0015:Ints2 UTSW 11 86249287 missense probably damaging 1.00
R0355:Ints2 UTSW 11 86234749 missense probably benign 0.00
R0389:Ints2 UTSW 11 86248851 missense probably damaging 1.00
R0631:Ints2 UTSW 11 86233196 missense probably benign 0.02
R0944:Ints2 UTSW 11 86244463 missense possibly damaging 0.85
R1268:Ints2 UTSW 11 86233085 missense probably damaging 1.00
R1269:Ints2 UTSW 11 86233085 missense probably damaging 1.00
R1270:Ints2 UTSW 11 86233085 missense probably damaging 1.00
R1396:Ints2 UTSW 11 86249248 missense probably damaging 0.98
R1474:Ints2 UTSW 11 86226781 missense probably damaging 0.97
R1503:Ints2 UTSW 11 86226781 missense probably damaging 0.97
R1840:Ints2 UTSW 11 86233085 missense probably damaging 1.00
R1987:Ints2 UTSW 11 86217800 missense probably benign 0.03
R1990:Ints2 UTSW 11 86248934 missense possibly damaging 0.58
R1991:Ints2 UTSW 11 86248934 missense possibly damaging 0.58
R3694:Ints2 UTSW 11 86243001 missense probably benign 0.41
R4056:Ints2 UTSW 11 86242952 missense probably damaging 1.00
R4057:Ints2 UTSW 11 86242952 missense probably damaging 1.00
R4569:Ints2 UTSW 11 86256198 missense probably damaging 1.00
R4585:Ints2 UTSW 11 86249275 missense probably damaging 1.00
R4586:Ints2 UTSW 11 86249275 missense probably damaging 1.00
R4806:Ints2 UTSW 11 86256209 missense probably benign 0.10
R4929:Ints2 UTSW 11 86212653 missense possibly damaging 0.56
R5031:Ints2 UTSW 11 86256200 missense probably damaging 1.00
R5064:Ints2 UTSW 11 86249274 missense probably damaging 1.00
R5270:Ints2 UTSW 11 86215795 missense probably damaging 1.00
R5621:Ints2 UTSW 11 86242947 missense probably benign 0.32
R5875:Ints2 UTSW 11 86238312 missense probably benign 0.04
R5908:Ints2 UTSW 11 86215545 critical splice donor site probably null
R5914:Ints2 UTSW 11 86222174 missense probably benign 0.03
R5941:Ints2 UTSW 11 86250972 missense probably benign 0.01
R5975:Ints2 UTSW 11 86226748 missense possibly damaging 0.72
R6003:Ints2 UTSW 11 86238468 missense probably damaging 1.00
R6091:Ints2 UTSW 11 86236603 missense probably damaging 0.96
R6209:Ints2 UTSW 11 86225058 missense probably damaging 1.00
R6567:Ints2 UTSW 11 86226661 missense probably benign 0.42
R6764:Ints2 UTSW 11 86212779 missense probably benign 0.00
R7033:Ints2 UTSW 11 86233085 missense probably damaging 1.00
R7132:Ints2 UTSW 11 86217754 missense probably benign 0.26
R7337:Ints2 UTSW 11 86217842 missense probably benign 0.00
R7410:Ints2 UTSW 11 86233226 missense probably benign 0.02
R7483:Ints2 UTSW 11 86215618 missense probably damaging 1.00
R7503:Ints2 UTSW 11 86232055 missense probably benign
R7804:Ints2 UTSW 11 86212663 missense possibly damaging 0.92
R7845:Ints2 UTSW 11 86238263 missense possibly damaging 0.93
R7875:Ints2 UTSW 11 86213062 missense probably damaging 0.99
R7918:Ints2 UTSW 11 86222217 missense probably damaging 1.00
R7922:Ints2 UTSW 11 86244627 missense probably benign 0.29
R8058:Ints2 UTSW 11 86255353 missense probably benign 0.05
R8134:Ints2 UTSW 11 86212660 missense probably damaging 1.00
R8295:Ints2 UTSW 11 86225088 missense probably damaging 0.97
R8348:Ints2 UTSW 11 86255423 missense probably benign
R8448:Ints2 UTSW 11 86255423 missense probably benign
R8784:Ints2 UTSW 11 86222137 missense probably damaging 1.00
R8784:Ints2 UTSW 11 86225115 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTCTAGAGAATCTGCTCCAAACACC -3'
(R):5'- TTGCTTGCCGACTGAAGAGG -3'

Sequencing Primer
(F):5'- GTGTCAGTAATTGAACTTTCCTGAC -3'
(R):5'- CTTGCCGACTGAAGAGGAAAAG -3'
Posted On2020-07-13