Incidental Mutation 'R8189:Nrcam'
ID 635036
Institutional Source Beutler Lab
Gene Symbol Nrcam
Ensembl Gene ENSMUSG00000020598
Gene Name neuronal cell adhesion molecule
Synonyms C130076O07Rik, C030017F07Rik, Bravo
MMRRC Submission 067612-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8189 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 44375668-44648747 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 44617291 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Threonine at position 740 (P740T)
Ref Sequence ENSEMBL: ENSMUSP00000020939 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020939] [ENSMUST00000110748]
AlphaFold Q810U4
Predicted Effect possibly damaging
Transcript: ENSMUST00000020939
AA Change: P740T

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000020939
Gene: ENSMUSG00000020598
AA Change: P740T

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
IGc2 53 124 5.37e-4 SMART
IG 146 233 3.91e-6 SMART
IGc2 277 341 1.73e-16 SMART
IGc2 367 433 4.85e-11 SMART
IGc2 461 526 4.92e-12 SMART
IGc2 552 617 6.55e-8 SMART
low complexity region 618 623 N/A INTRINSIC
FN3 641 724 3.24e-10 SMART
FN3 738 824 1.77e-2 SMART
FN3 840 931 1.97e-9 SMART
FN3 946 1031 3.73e-10 SMART
transmembrane domain 1120 1142 N/A INTRINSIC
Pfam:Bravo_FIGEY 1143 1232 2.9e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110748
AA Change: P730T

PolyPhen 2 Score 0.124 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000106376
Gene: ENSMUSG00000020598
AA Change: P730T

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
IGc2 53 124 5.37e-4 SMART
IG 146 233 3.91e-6 SMART
IGc2 277 341 1.73e-16 SMART
IGc2 367 433 4.85e-11 SMART
IGc2 461 526 4.92e-12 SMART
IGc2 552 617 6.55e-8 SMART
FN3 631 714 3.24e-10 SMART
FN3 728 814 1.77e-2 SMART
FN3 830 921 1.97e-9 SMART
FN3 936 1021 3.73e-10 SMART
transmembrane domain 1050 1072 N/A INTRINSIC
Pfam:Bravo_FIGEY 1073 1164 9.3e-35 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cell adhesion molecules (CAMs) are members of the immunoglobulin superfamily. This gene encodes a neuronal cell adhesion molecule with multiple immunoglobulin-like C2-type domains and fibronectin type-III domains. This ankyrin-binding protein is involved in neuron-neuron adhesion and promotes directional signaling during axonal cone growth. This gene is also expressed in non-neural tissues and may play a general role in cell-cell communication via signaling from its intracellular domain to the actin cytoskeleton during directional cell migration. Allelic variants of this gene have been associated with autism and addiction vulnerability. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit disorganization of lens fibers, cellular disintegration, and accumulation of cellular debris resulting in cataracts. Mutants show mild reductions in cerebellar lobe size. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted, knock-out(2) Targeted, other(4) Gene trapped(2) Chemically induced(1)

Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A G 1: 71,324,885 (GRCm39) I1531T probably damaging Het
Ankrd13d G A 19: 4,320,880 (GRCm39) P516S probably benign Het
Bag6 A G 17: 35,364,214 (GRCm39) probably null Het
Cchcr1 A G 17: 35,837,563 (GRCm39) I422V probably benign Het
Ceacam1 A G 7: 25,173,343 (GRCm39) S282P probably damaging Het
Chka G T 19: 3,925,759 (GRCm39) E159* probably null Het
Ckmt2 T C 13: 92,003,894 (GRCm39) Y368C probably damaging Het
Cngb1 TTCTGGCTCTGGCTCTGGCTCTGGCTCTGGCTCTGGCTCTGGCTCTGGCTCTGGCTCTGGCTCTGGCTCTGG TTCTGGCTCTGGCTCTGGCTCTGG 8: 96,030,248 (GRCm39) probably benign Het
Ctsq A G 13: 61,184,969 (GRCm39) L239P probably damaging Het
D630045J12Rik A G 6: 38,135,106 (GRCm39) L1358P probably damaging Het
Dglucy G A 12: 100,804,889 (GRCm39) E127K probably benign Het
Dnajb8 C T 6: 88,199,940 (GRCm39) R159C possibly damaging Het
Fgd6 T C 10: 93,910,077 (GRCm39) L794P probably benign Het
Fgfr2 G A 7: 129,774,629 (GRCm39) T654I probably damaging Het
Gmeb2 G A 2: 180,919,760 (GRCm39) T38M probably damaging Het
Gria1 T C 11: 57,108,625 (GRCm39) F243L probably benign Het
Gria2 A T 3: 80,629,489 (GRCm39) D244E probably damaging Het
Ints2 T A 11: 86,106,396 (GRCm39) I1005F probably damaging Het
Ipo11 T A 13: 107,061,604 (GRCm39) S19C probably damaging Het
Kmt2b A G 7: 30,268,756 (GRCm39) F2658L probably damaging Het
Lrrc38 G A 4: 143,077,303 (GRCm39) G189R probably damaging Het
Mcf2l A G 8: 13,013,164 (GRCm39) D27G probably damaging Het
Mrgprb2 G T 7: 48,202,502 (GRCm39) Y74* probably null Het
Mtrex T A 13: 113,028,515 (GRCm39) R628S possibly damaging Het
Nrxn1 C T 17: 91,011,637 (GRCm39) V331I probably damaging Het
Or2a57 T C 6: 43,213,013 (GRCm39) V157A probably benign Het
Or4f17-ps1 T C 2: 111,358,118 (GRCm39) V153A Het
Or5k1b T A 16: 58,581,288 (GRCm39) N84Y probably damaging Het
Or5p52 A G 7: 107,501,939 (GRCm39) N5S probably damaging Het
Or6c66b T A 10: 129,377,122 (GRCm39) C239S probably damaging Het
Pla2g4a A G 1: 149,733,337 (GRCm39) F479L probably benign Het
Pramel20 T G 4: 143,298,530 (GRCm39) Y158D probably benign Het
Scaper A T 9: 55,819,404 (GRCm39) F104I probably damaging Het
Serpinb3c A T 1: 107,204,039 (GRCm39) C58S probably benign Het
Setdb1 A G 3: 95,254,022 (GRCm39) V260A probably damaging Het
Shank3 A G 15: 89,433,439 (GRCm39) T1395A probably benign Het
Slc35b4 A G 6: 34,144,570 (GRCm39) I95T probably damaging Het
Trpm5 A G 7: 142,635,575 (GRCm39) V599A probably benign Het
Ttk A G 9: 83,729,272 (GRCm39) S352G probably benign Het
Ugt2b35 T A 5: 87,149,302 (GRCm39) S184R probably damaging Het
Usp17le C T 7: 104,418,555 (GRCm39) D196N probably damaging Het
Vmn2r15 A G 5: 109,434,713 (GRCm39) F664L probably benign Het
Vmn2r94 A T 17: 18,478,618 (GRCm39) L43Q probably damaging Het
Other mutations in Nrcam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01399:Nrcam APN 12 44,622,667 (GRCm39) missense probably benign 0.27
IGL01657:Nrcam APN 12 44,606,583 (GRCm39) missense probably damaging 1.00
IGL02434:Nrcam APN 12 44,637,026 (GRCm39) splice site probably benign
IGL02455:Nrcam APN 12 44,617,313 (GRCm39) missense probably damaging 1.00
IGL02712:Nrcam APN 12 44,620,610 (GRCm39) missense probably damaging 1.00
IGL02834:Nrcam APN 12 44,587,858 (GRCm39) critical splice donor site probably null
IGL03022:Nrcam APN 12 44,645,225 (GRCm39) missense probably damaging 1.00
IGL03174:Nrcam APN 12 44,622,789 (GRCm39) splice site probably benign
IGL03389:Nrcam APN 12 44,596,689 (GRCm39) missense probably benign 0.00
IGL03397:Nrcam APN 12 44,606,540 (GRCm39) missense probably damaging 1.00
I2288:Nrcam UTSW 12 44,611,098 (GRCm39) missense probably benign 0.06
I2289:Nrcam UTSW 12 44,611,098 (GRCm39) missense probably benign 0.06
R0063:Nrcam UTSW 12 44,596,811 (GRCm39) missense possibly damaging 0.49
R0063:Nrcam UTSW 12 44,596,811 (GRCm39) missense possibly damaging 0.49
R0195:Nrcam UTSW 12 44,631,628 (GRCm39) missense probably benign 0.00
R0463:Nrcam UTSW 12 44,598,124 (GRCm39) missense probably damaging 1.00
R0590:Nrcam UTSW 12 44,610,815 (GRCm39) missense probably damaging 1.00
R0674:Nrcam UTSW 12 44,611,105 (GRCm39) missense probably benign 0.17
R0930:Nrcam UTSW 12 44,596,667 (GRCm39) missense probably benign
R1241:Nrcam UTSW 12 44,636,947 (GRCm39) missense probably damaging 1.00
R1279:Nrcam UTSW 12 44,591,660 (GRCm39) splice site probably null
R1523:Nrcam UTSW 12 44,619,032 (GRCm39) missense probably damaging 1.00
R1572:Nrcam UTSW 12 44,584,147 (GRCm39) splice site probably benign
R1629:Nrcam UTSW 12 44,610,769 (GRCm39) missense probably benign 0.00
R1651:Nrcam UTSW 12 44,623,462 (GRCm39) missense probably damaging 0.97
R1729:Nrcam UTSW 12 44,620,633 (GRCm39) missense probably benign
R1739:Nrcam UTSW 12 44,618,458 (GRCm39) missense probably damaging 1.00
R1803:Nrcam UTSW 12 44,618,991 (GRCm39) missense probably benign
R1884:Nrcam UTSW 12 44,591,538 (GRCm39) missense probably damaging 1.00
R1974:Nrcam UTSW 12 44,610,776 (GRCm39) missense probably benign 0.05
R1992:Nrcam UTSW 12 44,587,753 (GRCm39) missense probably damaging 1.00
R2102:Nrcam UTSW 12 44,623,471 (GRCm39) missense probably benign 0.00
R2106:Nrcam UTSW 12 44,617,073 (GRCm39) missense probably benign 0.12
R3854:Nrcam UTSW 12 44,622,667 (GRCm39) missense probably benign 0.27
R4005:Nrcam UTSW 12 44,579,429 (GRCm39) missense probably benign
R4088:Nrcam UTSW 12 44,618,985 (GRCm39) missense possibly damaging 0.93
R4115:Nrcam UTSW 12 44,613,109 (GRCm39) missense possibly damaging 0.87
R4428:Nrcam UTSW 12 44,623,558 (GRCm39) missense possibly damaging 0.95
R4458:Nrcam UTSW 12 44,606,513 (GRCm39) missense probably damaging 1.00
R4580:Nrcam UTSW 12 44,609,323 (GRCm39) critical splice donor site probably null
R4601:Nrcam UTSW 12 44,637,839 (GRCm39) missense probably damaging 1.00
R4688:Nrcam UTSW 12 44,594,020 (GRCm39) missense probably benign
R4825:Nrcam UTSW 12 44,622,769 (GRCm39) nonsense probably null
R4838:Nrcam UTSW 12 44,620,802 (GRCm39) missense probably damaging 1.00
R4950:Nrcam UTSW 12 44,645,273 (GRCm39) missense probably damaging 1.00
R4960:Nrcam UTSW 12 44,613,082 (GRCm39) missense probably benign 0.01
R5081:Nrcam UTSW 12 44,617,136 (GRCm39) missense probably benign 0.00
R5297:Nrcam UTSW 12 44,591,567 (GRCm39) missense probably damaging 1.00
R5504:Nrcam UTSW 12 44,610,915 (GRCm39) critical splice donor site probably null
R5593:Nrcam UTSW 12 44,606,483 (GRCm39) missense probably damaging 1.00
R5654:Nrcam UTSW 12 44,610,841 (GRCm39) missense probably benign
R5691:Nrcam UTSW 12 44,611,039 (GRCm39) missense probably damaging 1.00
R5890:Nrcam UTSW 12 44,623,554 (GRCm39) missense probably benign
R5937:Nrcam UTSW 12 44,619,074 (GRCm39) missense probably benign 0.00
R5980:Nrcam UTSW 12 44,618,416 (GRCm39) missense probably damaging 1.00
R6132:Nrcam UTSW 12 44,617,007 (GRCm39) missense probably damaging 1.00
R6213:Nrcam UTSW 12 44,609,215 (GRCm39) missense possibly damaging 0.90
R6334:Nrcam UTSW 12 44,619,083 (GRCm39) missense probably benign
R6617:Nrcam UTSW 12 44,587,746 (GRCm39) missense probably damaging 1.00
R6666:Nrcam UTSW 12 44,618,338 (GRCm39) missense probably damaging 1.00
R7191:Nrcam UTSW 12 44,619,027 (GRCm39) missense probably benign 0.01
R7284:Nrcam UTSW 12 44,610,817 (GRCm39) missense probably damaging 1.00
R7326:Nrcam UTSW 12 44,610,809 (GRCm39) missense possibly damaging 0.95
R7388:Nrcam UTSW 12 44,645,272 (GRCm39) missense probably damaging 1.00
R7650:Nrcam UTSW 12 44,594,105 (GRCm39) missense probably damaging 1.00
R7734:Nrcam UTSW 12 44,584,034 (GRCm39) missense possibly damaging 0.49
R7757:Nrcam UTSW 12 44,596,681 (GRCm39) nonsense probably null
R7840:Nrcam UTSW 12 44,587,858 (GRCm39) critical splice donor site probably null
R7917:Nrcam UTSW 12 44,620,546 (GRCm39) splice site probably null
R7935:Nrcam UTSW 12 44,631,644 (GRCm39) missense possibly damaging 0.92
R7955:Nrcam UTSW 12 44,631,737 (GRCm39) missense probably benign 0.26
R8117:Nrcam UTSW 12 44,618,371 (GRCm39) missense probably benign 0.04
R8117:Nrcam UTSW 12 44,645,365 (GRCm39) missense probably damaging 1.00
R8153:Nrcam UTSW 12 44,631,755 (GRCm39) missense probably benign
R8215:Nrcam UTSW 12 44,610,896 (GRCm39) missense probably benign 0.02
R8719:Nrcam UTSW 12 44,586,325 (GRCm39) missense probably benign
R8738:Nrcam UTSW 12 44,619,075 (GRCm39) missense possibly damaging 0.67
R8794:Nrcam UTSW 12 44,624,958 (GRCm39) missense probably benign 0.01
R8831:Nrcam UTSW 12 44,591,680 (GRCm39) critical splice donor site probably null
R8858:Nrcam UTSW 12 44,644,554 (GRCm39) splice site probably benign
R8885:Nrcam UTSW 12 44,610,908 (GRCm39) missense probably benign 0.10
R8912:Nrcam UTSW 12 44,645,366 (GRCm39) missense probably damaging 1.00
R9178:Nrcam UTSW 12 44,615,329 (GRCm39) missense possibly damaging 0.69
R9243:Nrcam UTSW 12 44,620,607 (GRCm39) missense probably damaging 1.00
R9257:Nrcam UTSW 12 44,610,837 (GRCm39) missense probably benign 0.27
R9266:Nrcam UTSW 12 44,636,917 (GRCm39) missense probably damaging 1.00
R9606:Nrcam UTSW 12 44,609,240 (GRCm39) missense probably damaging 0.97
R9623:Nrcam UTSW 12 44,636,931 (GRCm39) missense probably damaging 1.00
R9681:Nrcam UTSW 12 44,598,133 (GRCm39) missense probably null 1.00
R9747:Nrcam UTSW 12 44,645,192 (GRCm39) missense probably damaging 1.00
U24488:Nrcam UTSW 12 44,584,042 (GRCm39) missense probably damaging 1.00
X0057:Nrcam UTSW 12 44,598,199 (GRCm39) missense probably benign
X0066:Nrcam UTSW 12 44,596,812 (GRCm39) missense probably benign 0.00
Z1176:Nrcam UTSW 12 44,618,353 (GRCm39) missense probably damaging 1.00
Z1177:Nrcam UTSW 12 44,620,799 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCATGGCAGAGAACAGCATTG -3'
(R):5'- AAAGCTGGGACTCTCACCTG -3'

Sequencing Primer
(F):5'- CAGCATTGGGAGAAGTATGCC -3'
(R):5'- CTGTCCATTTTGGTCACCGAAATAG -3'
Posted On 2020-07-13