Incidental Mutation 'R8189:Ctsq'
ID635038
Institutional Source Beutler Lab
Gene Symbol Ctsq
Ensembl Gene ENSMUSG00000021439
Gene Namecathepsin Q
Synonyms1600010J02Rik
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_029636.3; MGI:2137385

Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R8189 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location61035024-61040631 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 61037155 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 239 (L239P)
Ref Sequence ENSEMBL: ENSMUSP00000021888 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021888]
Predicted Effect probably damaging
Transcript: ENSMUST00000021888
AA Change: L239P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000021888
Gene: ENSMUSG00000021439
AA Change: L239P

DomainStartEndE-ValueType
Inhibitor_I29 29 88 3.76e-24 SMART
Pept_C1 125 342 3.46e-103 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030617O03Rik G A 12: 100,838,630 E127K probably benign Het
Abca12 A G 1: 71,285,726 I1531T probably damaging Het
Ankrd13d G A 19: 4,270,852 P516S probably benign Het
BC080695 T G 4: 143,571,960 Y158D probably benign Het
Cchcr1 A G 17: 35,526,666 I422V probably benign Het
Ceacam1 A G 7: 25,473,918 S282P probably damaging Het
Chka G T 19: 3,875,759 E159* probably null Het
Ckmt2 T C 13: 91,855,775 Y368C probably damaging Het
Cngb1 TTCTGGCTCTGGCTCTGGCTCTGGCTCTGGCTCTGGCTCTGGCTCTGGCTCTGGCTCTGGCTCTGGCTCTGG TTCTGGCTCTGGCTCTGGCTCTGG 8: 95,303,620 probably benign Het
D630045J12Rik A G 6: 38,158,171 L1358P probably damaging Het
Dnajb8 C T 6: 88,222,958 R159C possibly damaging Het
Fgd6 T C 10: 94,074,215 L794P probably benign Het
Fgfr2 G A 7: 130,172,899 T654I probably damaging Het
Gmeb2 G A 2: 181,277,967 T38M probably damaging Het
Gria1 T C 11: 57,217,799 F243L probably benign Het
Gria2 A T 3: 80,722,182 D244E probably damaging Het
Ints2 T A 11: 86,215,570 I1005F probably damaging Het
Ipo11 T A 13: 106,925,096 S19C probably damaging Het
Kmt2b A G 7: 30,569,331 F2658L probably damaging Het
Lrrc38 G A 4: 143,350,733 G189R probably damaging Het
Mcf2l A G 8: 12,963,164 D27G probably damaging Het
Mrgprb2 G T 7: 48,552,754 Y74* probably null Het
Nrcam C A 12: 44,570,508 P740T possibly damaging Het
Nrxn1 C T 17: 90,704,209 V331I probably damaging Het
Olfr1293-ps T C 2: 111,527,773 V153A Het
Olfr172 T A 16: 58,760,925 N84Y probably damaging Het
Olfr47 T C 6: 43,236,079 V157A probably benign Het
Olfr472 A G 7: 107,902,732 N5S probably damaging Het
Olfr792 T A 10: 129,541,253 C239S probably damaging Het
Pla2g4a A G 1: 149,857,586 F479L probably benign Het
Scaper A T 9: 55,912,120 F104I probably damaging Het
Serpinb3c A T 1: 107,276,309 C58S probably benign Het
Setdb1 A G 3: 95,346,711 V260A probably damaging Het
Shank3 A G 15: 89,549,236 T1395A probably benign Het
Skiv2l2 T A 13: 112,891,981 R628S possibly damaging Het
Slc35b4 A G 6: 34,167,635 I95T probably damaging Het
Trpm5 A G 7: 143,081,838 V599A probably benign Het
Ttk A G 9: 83,847,219 S352G probably benign Het
Ugt2b35 T A 5: 87,001,443 S184R probably damaging Het
Usp17le C T 7: 104,769,348 D196N probably damaging Het
Vmn2r15 A G 5: 109,286,847 F664L probably benign Het
Vmn2r94 A T 17: 18,258,356 L43Q probably damaging Het
Other mutations in Ctsq
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Ctsq APN 13 61037714 missense probably damaging 0.96
IGL00585:Ctsq APN 13 61037127 missense probably benign 0.00
IGL00743:Ctsq APN 13 61036184 missense probably damaging 1.00
IGL00897:Ctsq APN 13 61037725 missense probably damaging 1.00
IGL01679:Ctsq APN 13 61038908 missense probably benign 0.00
IGL01982:Ctsq APN 13 61038918 missense probably benign
IGL01982:Ctsq APN 13 61039521 missense probably benign 0.05
IGL02448:Ctsq APN 13 61036230 missense probably damaging 1.00
R0036:Ctsq UTSW 13 61037671 critical splice donor site probably null
R0036:Ctsq UTSW 13 61037671 critical splice donor site probably null
R0741:Ctsq UTSW 13 61036205 missense probably damaging 0.99
R1192:Ctsq UTSW 13 61039045 missense probably damaging 1.00
R1593:Ctsq UTSW 13 61036172 splice site probably null
R3906:Ctsq UTSW 13 61038771 missense probably damaging 1.00
R4483:Ctsq UTSW 13 61038912 missense probably benign 0.01
R4590:Ctsq UTSW 13 61036214 missense probably benign 0.17
R5157:Ctsq UTSW 13 61037099 missense probably benign 0.00
R5365:Ctsq UTSW 13 61037818 missense possibly damaging 0.95
R5366:Ctsq UTSW 13 61037099 missense probably benign 0.00
R5546:Ctsq UTSW 13 61037888 nonsense probably null
R5595:Ctsq UTSW 13 61037060 missense probably benign 0.41
R6046:Ctsq UTSW 13 61039141 missense probably benign 0.00
R6049:Ctsq UTSW 13 61038758 critical splice donor site probably null
R6535:Ctsq UTSW 13 61035326 missense probably damaging 1.00
R6537:Ctsq UTSW 13 61035326 missense probably damaging 1.00
R7159:Ctsq UTSW 13 61038923 missense probably benign 0.00
Z1176:Ctsq UTSW 13 61037123 missense probably benign 0.01
Z1177:Ctsq UTSW 13 61037096 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAGACGTTCATATCAGGTG -3'
(R):5'- GCGTGAAAGTATCAGTATGGC -3'

Sequencing Primer
(F):5'- GCAGACGTTCATATCAGGTGAAATTC -3'
(R):5'- TTGTGTACATGGAGAATATGGAAAC -3'
Posted On2020-07-13