Incidental Mutation 'V1662:Daam2'
ID 63504
Institutional Source Beutler Lab
Gene Symbol Daam2
Ensembl Gene ENSMUSG00000040260
Gene Name dishevelled associated activator of morphogenesis 2
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # V1662 () of strain 633
Quality Score 160
Status Not validated
Chromosome 17
Chromosomal Location 49456022-49564343 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 49464601 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 839 (L839P)
Ref Sequence ENSEMBL: ENSMUSP00000052085 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057610]
AlphaFold Q80U19
Predicted Effect possibly damaging
Transcript: ENSMUST00000057610
AA Change: L839P

PolyPhen 2 Score 0.848 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000052085
Gene: ENSMUSG00000040260
AA Change: L839P

DomainStartEndE-ValueType
Drf_GBD 40 228 4.89e-61 SMART
Drf_FH3 231 429 1.19e-73 SMART
Blast:FH2 476 513 4e-10 BLAST
low complexity region 514 534 N/A INTRINSIC
low complexity region 539 576 N/A INTRINSIC
FH2 595 1085 7.36e-99 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224954
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous KO in combination with homozygous Daam1 conditional KO increases the severity of the heart phenotype (abnormal ventricular morphology and pressure) of the Daam1 single KO. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb G C 5: 114,238,708 G1951R probably damaging Het
Adamts12 T A 15: 11,071,808 L146Q probably benign Het
Adgra1 T C 7: 139,852,579 I111T probably damaging Het
Amph G A 13: 19,139,370 V601M probably benign Het
Arfgef1 T C 1: 10,173,253 K1024E probably damaging Het
Arhgef2 G A 3: 88,633,329 R154Q probably damaging Het
Bank1 T A 3: 136,054,418 D782V probably damaging Het
Bhlha9 G T 11: 76,673,036 R163L probably benign Het
Cacna1h T C 17: 25,377,309 N1913D possibly damaging Het
Cd7 T C 11: 121,037,126 I184V probably benign Het
Cdk2ap1 T A 5: 124,348,676 I68F possibly damaging Het
Cfap44 C A 16: 44,449,138 Y1168* probably null Het
D6Ertd527e T C 6: 87,111,892 S346P unknown Het
Fam198a A G 9: 121,965,025 R82G probably damaging Het
Gm7030 A G 17: 36,128,931 Y104H probably benign Het
Golgb1 A G 16: 36,898,542 H270R probably benign Het
Itgav C T 2: 83,783,854 R519W possibly damaging Het
Lrp1b A T 2: 41,122,932 I2001K probably damaging Het
Lrrc40 T A 3: 158,052,789 I277K probably damaging Het
Olfr1025-ps1 C A 2: 85,918,594 T223K probably benign Het
Olfr1350 A T 7: 6,570,819 Y276F probably damaging Het
Olfr1373 T C 11: 52,145,177 M118V probably damaging Het
Olfr524 C T 7: 140,201,958 D271N possibly damaging Het
Pyroxd1 G A 6: 142,358,443 G307S probably damaging Het
Rp1 T A 1: 4,349,560 Y443F probably damaging Het
Rpusd4 C A 9: 35,272,761 S237R probably benign Het
Sdk2 A C 11: 113,834,908 W1172G probably damaging Het
Utrn A G 10: 12,421,640 Y675H probably damaging Het
Vmn1r193 A G 13: 22,219,075 I249T possibly damaging Het
Other mutations in Daam2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02150:Daam2 APN 17 49490304 missense possibly damaging 0.82
IGL02373:Daam2 APN 17 49473380 missense probably damaging 1.00
IGL02626:Daam2 APN 17 49490254 missense possibly damaging 0.46
IGL02793:Daam2 APN 17 49464028 missense probably damaging 1.00
IGL02861:Daam2 APN 17 49469427 missense probably damaging 1.00
IGL02875:Daam2 APN 17 49464028 missense probably damaging 1.00
IGL03370:Daam2 APN 17 49486501 missense probably benign 0.19
R0145:Daam2 UTSW 17 49480778 missense probably benign
R0310:Daam2 UTSW 17 49463924 critical splice donor site probably null
R0362:Daam2 UTSW 17 49480785 splice site probably null
R0423:Daam2 UTSW 17 49469421 nonsense probably null
R0883:Daam2 UTSW 17 49498883 utr 5 prime probably benign
R0928:Daam2 UTSW 17 49488227 missense probably benign 0.30
R1444:Daam2 UTSW 17 49480751 missense possibly damaging 0.89
R1559:Daam2 UTSW 17 49496120 splice site probably benign
R1733:Daam2 UTSW 17 49490203 missense possibly damaging 0.60
R1919:Daam2 UTSW 17 49485457 missense probably benign 0.00
R1930:Daam2 UTSW 17 49462213 splice site probably null
R1968:Daam2 UTSW 17 49483060 missense probably damaging 1.00
R2520:Daam2 UTSW 17 49480757 nonsense probably null
R3004:Daam2 UTSW 17 49460654 missense probably damaging 0.98
R3726:Daam2 UTSW 17 49469738 missense probably damaging 1.00
R3854:Daam2 UTSW 17 49458596 missense probably benign
R4833:Daam2 UTSW 17 49490145 missense possibly damaging 0.91
R4878:Daam2 UTSW 17 49460710 missense probably damaging 1.00
R5015:Daam2 UTSW 17 49476522 missense probably damaging 1.00
R5106:Daam2 UTSW 17 49476461 missense probably damaging 1.00
R5184:Daam2 UTSW 17 49494391 missense possibly damaging 0.50
R5419:Daam2 UTSW 17 49480754 missense possibly damaging 0.95
R5529:Daam2 UTSW 17 49459057 missense probably benign
R5974:Daam2 UTSW 17 49464473 missense probably damaging 1.00
R5979:Daam2 UTSW 17 49459204 missense possibly damaging 0.47
R6032:Daam2 UTSW 17 49486497 missense probably damaging 1.00
R6032:Daam2 UTSW 17 49486497 missense probably damaging 1.00
R6050:Daam2 UTSW 17 49486502 missense possibly damaging 0.78
R6180:Daam2 UTSW 17 49469666 missense probably damaging 0.99
R6225:Daam2 UTSW 17 49494439 missense probably damaging 0.98
R6385:Daam2 UTSW 17 49463936 missense probably damaging 1.00
R6426:Daam2 UTSW 17 49469376 missense probably damaging 1.00
R6427:Daam2 UTSW 17 49469376 missense probably damaging 1.00
R6428:Daam2 UTSW 17 49469376 missense probably damaging 1.00
R6539:Daam2 UTSW 17 49469711 missense probably damaging 1.00
R7090:Daam2 UTSW 17 49482945 missense probably damaging 0.99
R7108:Daam2 UTSW 17 49460674 missense probably damaging 1.00
R7487:Daam2 UTSW 17 49486482 missense probably benign 0.03
R7599:Daam2 UTSW 17 49480727 nonsense probably null
R7763:Daam2 UTSW 17 49490022 missense probably benign 0.04
R8039:Daam2 UTSW 17 49464538 missense probably damaging 1.00
R8700:Daam2 UTSW 17 49496152 missense probably damaging 1.00
R9000:Daam2 UTSW 17 49462169 missense probably damaging 1.00
R9286:Daam2 UTSW 17 49479894 missense possibly damaging 0.63
Z1177:Daam2 UTSW 17 49464620 missense probably damaging 1.00
Z1177:Daam2 UTSW 17 49489016 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGAGGAAGTTCATTGGTCCCCAC -3'
(R):5'- TCTGAGCACAGATGCTGCTGTC -3'

Sequencing Primer
(F):5'- ACCTGTCAATGCTGGACTTG -3'
(R):5'- cccttagattgtcctctgacc -3'
Posted On 2013-07-30