Incidental Mutation 'R8190:Pak6'
ID635054
Institutional Source Beutler Lab
Gene Symbol Pak6
Ensembl Gene ENSMUSG00000074923
Gene Namep21 (RAC1) activated kinase 6
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8190 (G1)
Quality Score199.009
Status Not validated
Chromosome2
Chromosomal Location118663303-118698020 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 118690097 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 190 (Q190*)
Ref Sequence ENSEMBL: ENSMUSP00000097153 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099557] [ENSMUST00000110853]
Predicted Effect probably null
Transcript: ENSMUST00000099557
AA Change: Q190*
SMART Domains Protein: ENSMUSP00000097153
Gene: ENSMUSG00000074923
AA Change: Q190*

DomainStartEndE-ValueType
PBD 12 47 4.47e-11 SMART
S_TKc 408 659 2.38e-89 SMART
Predicted Effect probably null
Transcript: ENSMUST00000110853
AA Change: Q190*
SMART Domains Protein: ENSMUSP00000106477
Gene: ENSMUSG00000074923
AA Change: Q190*

DomainStartEndE-ValueType
PBD 12 47 4.47e-11 SMART
S_TKc 408 659 2.38e-89 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of p21-stimulated serine/threonine protein kinases, which contain an amino-terminal Cdc42/Rac interactive binding (CRIB) domain and a carboxyl-terminal kinase domain. These kinases function in a number of cellular processes, including cytoskeleton rearrangement, apoptosis, and the mitogen-activated protein (MAP) kinase signaling pathway. The protein encoded by this gene interacts with androgen receptor (AR) and translocates to the nucleus, where it is involved in transcriptional regulation. Changes in expression of this gene have been linked to prostate cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a null allele do not exhibit any abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr8 T C 14: 29,984,073 V113A possibly damaging Het
Adcy7 A G 8: 88,311,038 M245V possibly damaging Het
Adgra1 G T 7: 139,876,118 R554L probably benign Het
Agfg2 T A 5: 137,655,402 M351L probably benign Het
Ahnak G A 19: 9,002,255 G301D probably benign Het
Ambra1 C T 2: 91,772,352 A227V possibly damaging Het
Ankrd24 T A 10: 81,638,318 D166E unknown Het
Anks1 C T 17: 27,986,804 P341S probably benign Het
Ano4 C T 10: 88,972,745 D766N probably benign Het
Apol7e A T 15: 77,717,807 T202S possibly damaging Het
Arhgap44 C A 11: 65,038,653 C275F probably damaging Het
Arl6ip4 A C 5: 124,117,032 K95T probably damaging Het
Bbs9 T C 9: 22,678,988 L674P probably damaging Het
BC080695 T G 4: 143,571,960 Y158D probably benign Het
Bmp4 T A 14: 46,384,515 M191L probably benign Het
Celsr1 A G 15: 85,902,889 L2753P probably damaging Het
Cerkl T A 2: 79,333,557 H473L probably benign Het
Cfap99 A T 5: 34,325,158 T538S possibly damaging Het
Clock A T 5: 76,227,204 V706E probably damaging Het
Cpne6 T C 14: 55,512,028 M15T probably benign Het
Deaf1 T C 7: 141,314,411 D351G probably damaging Het
Dnajb8 C T 6: 88,222,958 R159C possibly damaging Het
Eif3j1 A T 2: 122,047,488 D119V probably damaging Het
Eps8l1 C A 7: 4,471,298 S195Y probably benign Het
Exosc5 T C 7: 25,666,344 probably null Het
Fabp2 A T 3: 122,896,770 H34L probably benign Het
Fam179b T C 12: 65,006,912 V1322A probably damaging Het
Fbln5 T A 12: 101,757,296 Q382L probably damaging Het
Fbxo34 C A 14: 47,530,422 T464K possibly damaging Het
Fndc8 T G 11: 82,897,860 V172G probably damaging Het
Frs2 C T 10: 117,074,879 V193I possibly damaging Het
Gadd45a A G 6: 67,036,829 I44T possibly damaging Het
Gprin3 A G 6: 59,354,471 S284P possibly damaging Het
Gsta4 T C 9: 78,198,372 V28A possibly damaging Het
Herc1 T A 9: 66,418,451 D1402E probably benign Het
Hipk2 A T 6: 38,818,793 S180R possibly damaging Het
Hrg A T 16: 22,961,043 H357L unknown Het
Htr4 A G 18: 62,437,900 Q342R possibly damaging Het
Impa1 A G 3: 10,321,628 S184P possibly damaging Het
Iqgap3 A T 3: 88,090,779 Q281L probably damaging Het
Kcnh8 C T 17: 52,956,908 P811L probably damaging Het
Lpin1 T C 12: 16,549,002 I628V Het
Lrrc38 G A 4: 143,350,733 G189R probably damaging Het
Mfn1 A T 3: 32,568,389 I599F possibly damaging Het
Nalcn T A 14: 123,599,939 R4S possibly damaging Het
Nbeal2 C T 9: 110,626,090 R2580Q probably benign Het
Nlrp4b A G 7: 10,714,392 N174S probably damaging Het
Olfr399 T A 11: 74,054,479 R93S probably benign Het
Olfr487 A G 7: 108,211,807 F241L possibly damaging Het
Olfr68 A T 7: 103,777,595 V250D probably damaging Het
Olfr735 A T 14: 50,345,722 V240D probably damaging Het
Pabpc2 G A 18: 39,775,467 R595Q probably benign Het
Pds5a A T 5: 65,623,998 H1046Q probably damaging Het
Plin1 A G 7: 79,723,280 S314P probably benign Het
Ptpa G A 2: 30,438,339 S224N probably damaging Het
Rbp1 T G 9: 98,444,656 W107G probably damaging Het
Rgs7bp T C 13: 105,053,109 N61D probably damaging Het
Slc1a6 A G 10: 78,791,233 T135A probably damaging Het
Smarcc1 T A 9: 110,202,534 D783E probably benign Het
Sufu G T 19: 46,401,197 E86* probably null Het
Synm A T 7: 67,733,906 M1336K probably benign Het
Tgm1 C T 14: 55,704,884 G670D probably damaging Het
Tmc8 T G 11: 117,791,360 probably null Het
Uxs1 A T 1: 43,771,751 I225K possibly damaging Het
Vil1 G T 1: 74,434,893 E796* probably null Het
Vmn1r174 T C 7: 23,754,143 F78S probably damaging Het
Vps13d T A 4: 145,152,751 I1501F Het
Vps8 A T 16: 21,575,030 T1216S possibly damaging Het
Yipf4 G T 17: 74,493,972 R95L probably damaging Het
Zan T A 5: 137,467,084 T470S probably damaging Het
Zfp113 G T 5: 138,144,996 H331N probably damaging Het
Zfp62 A G 11: 49,216,075 Y331C probably damaging Het
Zfyve26 T C 12: 79,280,836 H580R probably benign Het
Other mutations in Pak6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Pak6 APN 2 118689845 missense possibly damaging 0.58
IGL00979:Pak6 APN 2 118696482 missense probably damaging 1.00
IGL01577:Pak6 APN 2 118693648 missense probably benign 0.00
IGL01928:Pak6 APN 2 118689864 missense probably damaging 1.00
IGL01951:Pak6 APN 2 118693260 missense probably benign
IGL02387:Pak6 APN 2 118693233 missense probably benign
IGL03302:Pak6 APN 2 118693303 missense probably benign
bedamned UTSW 2 118694007 splice site probably benign
bequeathed UTSW 2 118693522 missense probably damaging 0.96
R0126:Pak6 UTSW 2 118690332 missense possibly damaging 0.86
R0883:Pak6 UTSW 2 118693687 missense probably damaging 1.00
R1128:Pak6 UTSW 2 118696509 missense probably benign 0.00
R2073:Pak6 UTSW 2 118688851 missense probably damaging 1.00
R2508:Pak6 UTSW 2 118694569 nonsense probably null
R2920:Pak6 UTSW 2 118694007 splice site probably benign
R3118:Pak6 UTSW 2 118689741 missense probably damaging 1.00
R3689:Pak6 UTSW 2 118693440 nonsense probably null
R3762:Pak6 UTSW 2 118696477 missense probably damaging 0.99
R4589:Pak6 UTSW 2 118696540 missense probably damaging 1.00
R4976:Pak6 UTSW 2 118694548 missense probably damaging 1.00
R5119:Pak6 UTSW 2 118694548 missense probably damaging 1.00
R5206:Pak6 UTSW 2 118693303 missense probably benign
R5683:Pak6 UTSW 2 118693912 missense probably damaging 1.00
R7232:Pak6 UTSW 2 118693522 missense probably damaging 0.96
R7236:Pak6 UTSW 2 118693428 missense probably benign 0.26
R7292:Pak6 UTSW 2 118693591 missense possibly damaging 0.95
R7623:Pak6 UTSW 2 118694587 missense probably damaging 1.00
R7823:Pak6 UTSW 2 118695312 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGACCCCGATATGTACCTCC -3'
(R):5'- AACATGCTTCGGAAGAGCC -3'

Sequencing Primer
(F):5'- CGATATGTACCTCCAAAGCCC -3'
(R):5'- CTTAGGGCTAGGGCTGCCTTC -3'
Posted On2020-07-13