Incidental Mutation 'R8190:Impa1'
ID635056
Institutional Source Beutler Lab
Gene Symbol Impa1
Ensembl Gene ENSMUSG00000027531
Gene Nameinositol (myo)-1(or 4)-monophosphatase 1
Synonymslithium-sensitive myo-inositol monophosphatase A1, 2900059K10Rik, 2610002K09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8190 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location10311956-10331439 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 10321628 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 184 (S184P)
Ref Sequence ENSEMBL: ENSMUSP00000068174 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065938] [ENSMUST00000118410] [ENSMUST00000128912] [ENSMUST00000191670] [ENSMUST00000192603]
Predicted Effect possibly damaging
Transcript: ENSMUST00000065938
AA Change: S184P

PolyPhen 2 Score 0.478 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000068174
Gene: ENSMUSG00000027531
AA Change: S184P

DomainStartEndE-ValueType
Pfam:Inositol_P 5 271 1.5e-86 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000118410
AA Change: S184P

PolyPhen 2 Score 0.885 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000113860
Gene: ENSMUSG00000027531
AA Change: S184P

DomainStartEndE-ValueType
Pfam:Inositol_P 5 271 7.7e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128912
SMART Domains Protein: ENSMUSP00000116088
Gene: ENSMUSG00000027531

DomainStartEndE-ValueType
Pfam:Inositol_P 19 90 4.4e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000191670
SMART Domains Protein: ENSMUSP00000141345
Gene: ENSMUSG00000027531

DomainStartEndE-ValueType
Pfam:Inositol_P 5 180 4.7e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192603
SMART Domains Protein: ENSMUSP00000141735
Gene: ENSMUSG00000103392

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 69 85 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that dephosphorylates myo-inositol monophosphate to generate free myo-inositol, a precursor of phosphatidylinositol, and is therefore an important modulator of intracellular signal transduction via the production of the second messengers myoinositol 1,4,5-trisphosphate and diacylglycerol. This enzyme can also use myo-inositol-1,3-diphosphate, myo-inositol-1,4-diphosphate, scyllo-inositol-phosphate, glucose-1-phosphate, glucose-6-phosphate, fructose-1-phosphate, beta-glycerophosphate, and 2'-AMP as substrates. This enzyme shows magnesium-dependent phosphatase activity and is inhibited by therapeutic concentrations of lithium. Inhibition of inositol monophosphate hydroylosis and subsequent depletion of inositol for phosphatidylinositol synthesis may explain the anti-manic and anti-depressive effects of lithium administered to treat bipolar disorder. Alternative splicing results in multiple transcript variants encoding distinct isoforms. A pseudogene of this gene is also present on chromosome 8q21.13. [provided by RefSeq, Dec 2014]
PHENOTYPE: Most mice homozygous for a knock-out allele die between E9.5 and E10.5 with surviving mice exhibiting hyperactivity, increased rearing, and increased susceptibility to pilocarpine-induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr8 T C 14: 29,984,073 V113A possibly damaging Het
Adcy7 A G 8: 88,311,038 M245V possibly damaging Het
Adgra1 G T 7: 139,876,118 R554L probably benign Het
Agfg2 T A 5: 137,655,402 M351L probably benign Het
Ahnak G A 19: 9,002,255 G301D probably benign Het
Ambra1 C T 2: 91,772,352 A227V possibly damaging Het
Ankrd24 T A 10: 81,638,318 D166E unknown Het
Anks1 C T 17: 27,986,804 P341S probably benign Het
Ano4 C T 10: 88,972,745 D766N probably benign Het
Apol7e A T 15: 77,717,807 T202S possibly damaging Het
Arhgap44 C A 11: 65,038,653 C275F probably damaging Het
Arl6ip4 A C 5: 124,117,032 K95T probably damaging Het
Bbs9 T C 9: 22,678,988 L674P probably damaging Het
BC080695 T G 4: 143,571,960 Y158D probably benign Het
Bmp4 T A 14: 46,384,515 M191L probably benign Het
Celsr1 A G 15: 85,902,889 L2753P probably damaging Het
Cerkl T A 2: 79,333,557 H473L probably benign Het
Cfap99 A T 5: 34,325,158 T538S possibly damaging Het
Clock A T 5: 76,227,204 V706E probably damaging Het
Cpne6 T C 14: 55,512,028 M15T probably benign Het
Deaf1 T C 7: 141,314,411 D351G probably damaging Het
Dnajb8 C T 6: 88,222,958 R159C possibly damaging Het
Eif3j1 A T 2: 122,047,488 D119V probably damaging Het
Eps8l1 C A 7: 4,471,298 S195Y probably benign Het
Exosc5 T C 7: 25,666,344 probably null Het
Fabp2 A T 3: 122,896,770 H34L probably benign Het
Fam179b T C 12: 65,006,912 V1322A probably damaging Het
Fbln5 T A 12: 101,757,296 Q382L probably damaging Het
Fbxo34 C A 14: 47,530,422 T464K possibly damaging Het
Fndc8 T G 11: 82,897,860 V172G probably damaging Het
Frs2 C T 10: 117,074,879 V193I possibly damaging Het
Gadd45a A G 6: 67,036,829 I44T possibly damaging Het
Gprin3 A G 6: 59,354,471 S284P possibly damaging Het
Gsta4 T C 9: 78,198,372 V28A possibly damaging Het
Herc1 T A 9: 66,418,451 D1402E probably benign Het
Hipk2 A T 6: 38,818,793 S180R possibly damaging Het
Hrg A T 16: 22,961,043 H357L unknown Het
Htr4 A G 18: 62,437,900 Q342R possibly damaging Het
Iqgap3 A T 3: 88,090,779 Q281L probably damaging Het
Kcnh8 C T 17: 52,956,908 P811L probably damaging Het
Lpin1 T C 12: 16,549,002 I628V Het
Lrrc38 G A 4: 143,350,733 G189R probably damaging Het
Mfn1 A T 3: 32,568,389 I599F possibly damaging Het
Nalcn T A 14: 123,599,939 R4S possibly damaging Het
Nbeal2 C T 9: 110,626,090 R2580Q probably benign Het
Nlrp4b A G 7: 10,714,392 N174S probably damaging Het
Olfr399 T A 11: 74,054,479 R93S probably benign Het
Olfr487 A G 7: 108,211,807 F241L possibly damaging Het
Olfr68 A T 7: 103,777,595 V250D probably damaging Het
Olfr735 A T 14: 50,345,722 V240D probably damaging Het
Pabpc2 G A 18: 39,775,467 R595Q probably benign Het
Pak6 C T 2: 118,690,097 Q190* probably null Het
Pds5a A T 5: 65,623,998 H1046Q probably damaging Het
Plin1 A G 7: 79,723,280 S314P probably benign Het
Ptpa G A 2: 30,438,339 S224N probably damaging Het
Rbp1 T G 9: 98,444,656 W107G probably damaging Het
Rgs7bp T C 13: 105,053,109 N61D probably damaging Het
Slc1a6 A G 10: 78,791,233 T135A probably damaging Het
Smarcc1 T A 9: 110,202,534 D783E probably benign Het
Sufu G T 19: 46,401,197 E86* probably null Het
Synm A T 7: 67,733,906 M1336K probably benign Het
Tgm1 C T 14: 55,704,884 G670D probably damaging Het
Tmc8 T G 11: 117,791,360 probably null Het
Uxs1 A T 1: 43,771,751 I225K possibly damaging Het
Vil1 G T 1: 74,434,893 E796* probably null Het
Vmn1r174 T C 7: 23,754,143 F78S probably damaging Het
Vps13d T A 4: 145,152,751 I1501F Het
Vps8 A T 16: 21,575,030 T1216S possibly damaging Het
Yipf4 G T 17: 74,493,972 R95L probably damaging Het
Zan T A 5: 137,467,084 T470S probably damaging Het
Zfp113 G T 5: 138,144,996 H331N probably damaging Het
Zfp62 A G 11: 49,216,075 Y331C probably damaging Het
Zfyve26 T C 12: 79,280,836 H580R probably benign Het
Other mutations in Impa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01777:Impa1 APN 3 10322948 missense probably damaging 1.00
IGL02411:Impa1 APN 3 10322958 missense possibly damaging 0.90
IGL02733:Impa1 APN 3 10328965 missense probably benign
IGL03183:Impa1 APN 3 10322994 missense probably damaging 1.00
lofty UTSW 3 10329004 start codon destroyed probably null 1.00
olympian UTSW 3 10315280 missense probably damaging 1.00
R0166:Impa1 UTSW 3 10328960 missense probably damaging 0.99
R0782:Impa1 UTSW 3 10322896 splice site probably benign
R1645:Impa1 UTSW 3 10328441 missense possibly damaging 0.79
R3196:Impa1 UTSW 3 10329015 splice site probably null
R3905:Impa1 UTSW 3 10316034 missense probably benign
R4953:Impa1 UTSW 3 10315280 missense probably damaging 1.00
R5495:Impa1 UTSW 3 10326170 missense probably benign 0.08
R5884:Impa1 UTSW 3 10316224 missense probably damaging 1.00
R5972:Impa1 UTSW 3 10329004 start codon destroyed probably null 1.00
R6927:Impa1 UTSW 3 10315288 missense probably benign 0.00
R7605:Impa1 UTSW 3 10324087 missense probably damaging 0.96
R7801:Impa1 UTSW 3 10321667 missense probably benign
R8086:Impa1 UTSW 3 10322928 missense probably benign 0.02
X0054:Impa1 UTSW 3 10316100 splice site probably null
Z1177:Impa1 UTSW 3 10316074 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ACGGAATTCATCGCAAACG -3'
(R):5'- GCAGTCTTGTCAAACACCAC -3'

Sequencing Primer
(F):5'- GAAAATTCCCAAGGTCAACTCTAG -3'
(R):5'- ACACCACACCTATTTTCATAAGTG -3'
Posted On2020-07-13