Incidental Mutation 'R8190:Nlrp4b'
ID635075
Institutional Source Beutler Lab
Gene Symbol Nlrp4b
Ensembl Gene ENSMUSG00000034087
Gene NameNLR family, pyrin domain containing 4B
SynonymsNalp4b, Nalp-gamma
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R8190 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location10687789-10730168 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 10714392 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 174 (N174S)
Ref Sequence ENSEMBL: ENSMUSP00000043881 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047809] [ENSMUST00000117413] [ENSMUST00000132990] [ENSMUST00000211069]
Predicted Effect probably damaging
Transcript: ENSMUST00000047809
AA Change: N174S

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000043881
Gene: ENSMUSG00000034087
AA Change: N174S

DomainStartEndE-ValueType
PYRIN 6 89 1.4e-20 SMART
Pfam:NACHT 143 312 7.9e-40 PFAM
low complexity region 520 535 N/A INTRINSIC
LRR 683 710 4.9e0 SMART
LRR 712 739 1.97e0 SMART
LRR 740 767 1.13e-4 SMART
LRR 769 796 1.93e1 SMART
LRR 797 824 1.73e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000117413
AA Change: N174S

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000113095
Gene: ENSMUSG00000034087
AA Change: N174S

DomainStartEndE-ValueType
PYRIN 6 89 1.4e-20 SMART
Pfam:NACHT 143 312 3.3e-39 PFAM
low complexity region 520 535 N/A INTRINSIC
LRR 683 710 4.9e0 SMART
LRR 712 739 1.97e0 SMART
LRR 740 767 1.13e-4 SMART
LRR 769 796 1.93e1 SMART
LRR 797 824 1.73e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132990
SMART Domains Protein: ENSMUSP00000115831
Gene: ENSMUSG00000034087

DomainStartEndE-ValueType
low complexity region 153 168 N/A INTRINSIC
LRR 316 343 4.9e0 SMART
LRR 345 372 1.97e0 SMART
LRR 373 400 1.13e-4 SMART
LRR 402 429 1.93e1 SMART
LRR 430 457 1.73e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000211069
Predicted Effect probably benign
Transcript: ENSMUST00000211258
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr8 T C 14: 29,984,073 V113A possibly damaging Het
Adcy7 A G 8: 88,311,038 M245V possibly damaging Het
Adgra1 G T 7: 139,876,118 R554L probably benign Het
Agfg2 T A 5: 137,655,402 M351L probably benign Het
Ahnak G A 19: 9,002,255 G301D probably benign Het
Ambra1 C T 2: 91,772,352 A227V possibly damaging Het
Ankrd24 T A 10: 81,638,318 D166E unknown Het
Anks1 C T 17: 27,986,804 P341S probably benign Het
Ano4 C T 10: 88,972,745 D766N probably benign Het
Apol7e A T 15: 77,717,807 T202S possibly damaging Het
Arhgap44 C A 11: 65,038,653 C275F probably damaging Het
Arl6ip4 A C 5: 124,117,032 K95T probably damaging Het
Bbs9 T C 9: 22,678,988 L674P probably damaging Het
BC080695 T G 4: 143,571,960 Y158D probably benign Het
Bmp4 T A 14: 46,384,515 M191L probably benign Het
Celsr1 A G 15: 85,902,889 L2753P probably damaging Het
Cerkl T A 2: 79,333,557 H473L probably benign Het
Cfap99 A T 5: 34,325,158 T538S possibly damaging Het
Clock A T 5: 76,227,204 V706E probably damaging Het
Cpne6 T C 14: 55,512,028 M15T probably benign Het
Deaf1 T C 7: 141,314,411 D351G probably damaging Het
Dnajb8 C T 6: 88,222,958 R159C possibly damaging Het
Eif3j1 A T 2: 122,047,488 D119V probably damaging Het
Eps8l1 C A 7: 4,471,298 S195Y probably benign Het
Exosc5 T C 7: 25,666,344 probably null Het
Fabp2 A T 3: 122,896,770 H34L probably benign Het
Fam179b T C 12: 65,006,912 V1322A probably damaging Het
Fbln5 T A 12: 101,757,296 Q382L probably damaging Het
Fbxo34 C A 14: 47,530,422 T464K possibly damaging Het
Fndc8 T G 11: 82,897,860 V172G probably damaging Het
Frs2 C T 10: 117,074,879 V193I possibly damaging Het
Gadd45a A G 6: 67,036,829 I44T possibly damaging Het
Gprin3 A G 6: 59,354,471 S284P possibly damaging Het
Gsta4 T C 9: 78,198,372 V28A possibly damaging Het
Herc1 T A 9: 66,418,451 D1402E probably benign Het
Hipk2 A T 6: 38,818,793 S180R possibly damaging Het
Hrg A T 16: 22,961,043 H357L unknown Het
Htr4 A G 18: 62,437,900 Q342R possibly damaging Het
Impa1 A G 3: 10,321,628 S184P possibly damaging Het
Iqgap3 A T 3: 88,090,779 Q281L probably damaging Het
Kcnh8 C T 17: 52,956,908 P811L probably damaging Het
Lpin1 T C 12: 16,549,002 I628V Het
Lrrc38 G A 4: 143,350,733 G189R probably damaging Het
Mfn1 A T 3: 32,568,389 I599F possibly damaging Het
Nalcn T A 14: 123,599,939 R4S possibly damaging Het
Nbeal2 C T 9: 110,626,090 R2580Q probably benign Het
Olfr399 T A 11: 74,054,479 R93S probably benign Het
Olfr487 A G 7: 108,211,807 F241L possibly damaging Het
Olfr68 A T 7: 103,777,595 V250D probably damaging Het
Olfr735 A T 14: 50,345,722 V240D probably damaging Het
Pabpc2 G A 18: 39,775,467 R595Q probably benign Het
Pak6 C T 2: 118,690,097 Q190* probably null Het
Pds5a A T 5: 65,623,998 H1046Q probably damaging Het
Plin1 A G 7: 79,723,280 S314P probably benign Het
Ptpa G A 2: 30,438,339 S224N probably damaging Het
Rbp1 T G 9: 98,444,656 W107G probably damaging Het
Rgs7bp T C 13: 105,053,109 N61D probably damaging Het
Slc1a6 A G 10: 78,791,233 T135A probably damaging Het
Smarcc1 T A 9: 110,202,534 D783E probably benign Het
Sufu G T 19: 46,401,197 E86* probably null Het
Synm A T 7: 67,733,906 M1336K probably benign Het
Tgm1 C T 14: 55,704,884 G670D probably damaging Het
Tmc8 T G 11: 117,791,360 probably null Het
Uxs1 A T 1: 43,771,751 I225K possibly damaging Het
Vil1 G T 1: 74,434,893 E796* probably null Het
Vmn1r174 T C 7: 23,754,143 F78S probably damaging Het
Vps13d T A 4: 145,152,751 I1501F Het
Vps8 A T 16: 21,575,030 T1216S possibly damaging Het
Yipf4 G T 17: 74,493,972 R95L probably damaging Het
Zan T A 5: 137,467,084 T470S probably damaging Het
Zfp113 G T 5: 138,144,996 H331N probably damaging Het
Zfp62 A G 11: 49,216,075 Y331C probably damaging Het
Zfyve26 T C 12: 79,280,836 H580R probably benign Het
Other mutations in Nlrp4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00971:Nlrp4b APN 7 10714955 missense possibly damaging 0.68
IGL01456:Nlrp4b APN 7 10714223 missense probably benign 0.26
IGL01537:Nlrp4b APN 7 10714991 missense probably damaging 1.00
IGL02539:Nlrp4b APN 7 10714428 missense probably damaging 0.96
IGL02730:Nlrp4b APN 7 10714758 missense probably damaging 1.00
IGL02871:Nlrp4b APN 7 10715265 missense probably benign 0.26
IGL03008:Nlrp4b APN 7 10714589 missense probably benign 0.00
IGL03109:Nlrp4b APN 7 10714946 missense probably damaging 1.00
IGL03251:Nlrp4b APN 7 10714500 missense probably benign 0.01
IGL03354:Nlrp4b APN 7 10714538 missense probably damaging 0.99
R0052:Nlrp4b UTSW 7 10725962 nonsense probably null
R0348:Nlrp4b UTSW 7 10715181 missense possibly damaging 0.60
R0564:Nlrp4b UTSW 7 10714658 missense probably benign 0.15
R0573:Nlrp4b UTSW 7 10714215 missense probably benign 0.01
R0581:Nlrp4b UTSW 7 10714530 missense probably damaging 1.00
R1201:Nlrp4b UTSW 7 10715436 missense possibly damaging 0.64
R1541:Nlrp4b UTSW 7 10725052 missense possibly damaging 0.91
R1771:Nlrp4b UTSW 7 10718593 missense probably damaging 0.96
R1781:Nlrp4b UTSW 7 10715339 missense probably benign 0.13
R1833:Nlrp4b UTSW 7 10725936 missense probably benign 0.00
R2405:Nlrp4b UTSW 7 10714728 missense probably benign 0.08
R2871:Nlrp4b UTSW 7 10710243 nonsense probably null
R2871:Nlrp4b UTSW 7 10710243 nonsense probably null
R2873:Nlrp4b UTSW 7 10710243 nonsense probably null
R2904:Nlrp4b UTSW 7 10714367 missense probably damaging 1.00
R3410:Nlrp4b UTSW 7 10715529 missense probably damaging 1.00
R3714:Nlrp4b UTSW 7 10714881 missense probably benign 0.04
R3982:Nlrp4b UTSW 7 10714431 missense possibly damaging 0.95
R4668:Nlrp4b UTSW 7 10714733 missense possibly damaging 0.66
R4690:Nlrp4b UTSW 7 10719203 missense probably benign 0.00
R4857:Nlrp4b UTSW 7 10715298 missense probably benign 0.05
R5247:Nlrp4b UTSW 7 10714218 missense probably benign 0.21
R5381:Nlrp4b UTSW 7 10715245 nonsense probably null
R5529:Nlrp4b UTSW 7 10714946 missense possibly damaging 0.91
R5589:Nlrp4b UTSW 7 10715585 missense probably benign 0.34
R5770:Nlrp4b UTSW 7 10715487 missense probably benign 0.00
R5990:Nlrp4b UTSW 7 10714491 missense possibly damaging 0.61
R6049:Nlrp4b UTSW 7 10714713 nonsense probably null
R6329:Nlrp4b UTSW 7 10724920 missense probably benign 0.16
R6377:Nlrp4b UTSW 7 10715412 missense probably benign 0.00
R7107:Nlrp4b UTSW 7 10715217 missense probably damaging 0.96
R7209:Nlrp4b UTSW 7 10710370 missense probably benign 0.01
R7237:Nlrp4b UTSW 7 10715216 missense probably benign 0.12
R7537:Nlrp4b UTSW 7 10714889 missense probably benign 0.05
R7793:Nlrp4b UTSW 7 10725074 missense probably benign 0.00
R8138:Nlrp4b UTSW 7 10715531 missense probably benign 0.01
R8326:Nlrp4b UTSW 7 10718544 missense probably benign 0.05
R8353:Nlrp4b UTSW 7 10715601 missense probably damaging 0.99
R8417:Nlrp4b UTSW 7 10725953 nonsense probably null
R8453:Nlrp4b UTSW 7 10715601 missense probably damaging 0.99
X0063:Nlrp4b UTSW 7 10729587 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGGAGAAGCTGACCCATGATTG -3'
(R):5'- TGGGTAACATTCCATTCCATCC -3'

Sequencing Primer
(F):5'- GAGAAGCTGACCCATGATTGTTCTAG -3'
(R):5'- ATCCCTTCTAAGCTGTCAATGATG -3'
Posted On2020-07-13