Incidental Mutation 'R8190:Bbs9'
ID635085
Institutional Source Beutler Lab
Gene Symbol Bbs9
Ensembl Gene ENSMUSG00000035919
Gene NameBardet-Biedl syndrome 9 (human)
SynonymsE130103I17Rik, EST 3159894
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.793) question?
Stock #R8190 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location22475715-22888280 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 22678988 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 674 (L674P)
Ref Sequence ENSEMBL: ENSMUSP00000043042 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039798] [ENSMUST00000127296] [ENSMUST00000147405] [ENSMUST00000147712] [ENSMUST00000150395]
Predicted Effect probably damaging
Transcript: ENSMUST00000039798
AA Change: L674P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043042
Gene: ENSMUSG00000035919
AA Change: L674P

DomainStartEndE-ValueType
Pfam:PHTB1_N 1 421 8e-168 PFAM
Pfam:PHTB1_C 439 814 8.3e-163 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127296
Predicted Effect probably benign
Transcript: ENSMUST00000136084
SMART Domains Protein: ENSMUSP00000123160
Gene: ENSMUSG00000035919

DomainStartEndE-ValueType
Pfam:PHTB1_C 24 162 2.9e-45 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000147405
AA Change: L679P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120927
Gene: ENSMUSG00000035919
AA Change: L679P

DomainStartEndE-ValueType
Pfam:PHTB1_N 1 417 1.1e-166 PFAM
Pfam:PHTB1_C 440 818 7e-158 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000147712
AA Change: L674P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122058
Gene: ENSMUSG00000035919
AA Change: L674P

DomainStartEndE-ValueType
Pfam:PHTB1_N 1 421 8e-168 PFAM
Pfam:PHTB1_C 439 814 8.3e-163 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000150395
AA Change: L674P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116629
Gene: ENSMUSG00000035919
AA Change: L674P

DomainStartEndE-ValueType
Pfam:PHTB1_N 1 421 8e-168 PFAM
Pfam:PHTB1_C 439 814 8.3e-163 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is downregulated by parathyroid hormone in osteoblastic cells, and therefore is thought to be involved in parathyroid hormone action in bones. The exact function of this gene has not yet been determined. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr8 T C 14: 29,984,073 V113A possibly damaging Het
Adcy7 A G 8: 88,311,038 M245V possibly damaging Het
Adgra1 G T 7: 139,876,118 R554L probably benign Het
Agfg2 T A 5: 137,655,402 M351L probably benign Het
Ahnak G A 19: 9,002,255 G301D probably benign Het
Ambra1 C T 2: 91,772,352 A227V possibly damaging Het
Ankrd24 T A 10: 81,638,318 D166E unknown Het
Anks1 C T 17: 27,986,804 P341S probably benign Het
Ano4 C T 10: 88,972,745 D766N probably benign Het
Apol7e A T 15: 77,717,807 T202S possibly damaging Het
Arhgap44 C A 11: 65,038,653 C275F probably damaging Het
Arl6ip4 A C 5: 124,117,032 K95T probably damaging Het
BC080695 T G 4: 143,571,960 Y158D probably benign Het
Bmp4 T A 14: 46,384,515 M191L probably benign Het
Celsr1 A G 15: 85,902,889 L2753P probably damaging Het
Cerkl T A 2: 79,333,557 H473L probably benign Het
Cfap99 A T 5: 34,325,158 T538S possibly damaging Het
Clock A T 5: 76,227,204 V706E probably damaging Het
Cpne6 T C 14: 55,512,028 M15T probably benign Het
Deaf1 T C 7: 141,314,411 D351G probably damaging Het
Dnajb8 C T 6: 88,222,958 R159C possibly damaging Het
Eif3j1 A T 2: 122,047,488 D119V probably damaging Het
Eps8l1 C A 7: 4,471,298 S195Y probably benign Het
Exosc5 T C 7: 25,666,344 probably null Het
Fabp2 A T 3: 122,896,770 H34L probably benign Het
Fam179b T C 12: 65,006,912 V1322A probably damaging Het
Fbln5 T A 12: 101,757,296 Q382L probably damaging Het
Fbxo34 C A 14: 47,530,422 T464K possibly damaging Het
Fndc8 T G 11: 82,897,860 V172G probably damaging Het
Frs2 C T 10: 117,074,879 V193I possibly damaging Het
Gadd45a A G 6: 67,036,829 I44T possibly damaging Het
Gprin3 A G 6: 59,354,471 S284P possibly damaging Het
Gsta4 T C 9: 78,198,372 V28A possibly damaging Het
Herc1 T A 9: 66,418,451 D1402E probably benign Het
Hipk2 A T 6: 38,818,793 S180R possibly damaging Het
Hrg A T 16: 22,961,043 H357L unknown Het
Htr4 A G 18: 62,437,900 Q342R possibly damaging Het
Impa1 A G 3: 10,321,628 S184P possibly damaging Het
Iqgap3 A T 3: 88,090,779 Q281L probably damaging Het
Kcnh8 C T 17: 52,956,908 P811L probably damaging Het
Lpin1 T C 12: 16,549,002 I628V Het
Lrrc38 G A 4: 143,350,733 G189R probably damaging Het
Mfn1 A T 3: 32,568,389 I599F possibly damaging Het
Nalcn T A 14: 123,599,939 R4S possibly damaging Het
Nbeal2 C T 9: 110,626,090 R2580Q probably benign Het
Nlrp4b A G 7: 10,714,392 N174S probably damaging Het
Olfr399 T A 11: 74,054,479 R93S probably benign Het
Olfr487 A G 7: 108,211,807 F241L possibly damaging Het
Olfr68 A T 7: 103,777,595 V250D probably damaging Het
Olfr735 A T 14: 50,345,722 V240D probably damaging Het
Pabpc2 G A 18: 39,775,467 R595Q probably benign Het
Pak6 C T 2: 118,690,097 Q190* probably null Het
Pds5a A T 5: 65,623,998 H1046Q probably damaging Het
Plin1 A G 7: 79,723,280 S314P probably benign Het
Ptpa G A 2: 30,438,339 S224N probably damaging Het
Rbp1 T G 9: 98,444,656 W107G probably damaging Het
Rgs7bp T C 13: 105,053,109 N61D probably damaging Het
Slc1a6 A G 10: 78,791,233 T135A probably damaging Het
Smarcc1 T A 9: 110,202,534 D783E probably benign Het
Sufu G T 19: 46,401,197 E86* probably null Het
Synm A T 7: 67,733,906 M1336K probably benign Het
Tgm1 C T 14: 55,704,884 G670D probably damaging Het
Tmc8 T G 11: 117,791,360 probably null Het
Uxs1 A T 1: 43,771,751 I225K possibly damaging Het
Vil1 G T 1: 74,434,893 E796* probably null Het
Vmn1r174 T C 7: 23,754,143 F78S probably damaging Het
Vps13d T A 4: 145,152,751 I1501F Het
Vps8 A T 16: 21,575,030 T1216S possibly damaging Het
Yipf4 G T 17: 74,493,972 R95L probably damaging Het
Zan T A 5: 137,467,084 T470S probably damaging Het
Zfp113 G T 5: 138,144,996 H331N probably damaging Het
Zfp62 A G 11: 49,216,075 Y331C probably damaging Het
Zfyve26 T C 12: 79,280,836 H580R probably benign Het
Other mutations in Bbs9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01349:Bbs9 APN 9 22887683 missense probably benign 0.00
IGL01586:Bbs9 APN 9 22645997 missense possibly damaging 0.46
IGL01646:Bbs9 APN 9 22670925 nonsense probably null
IGL01654:Bbs9 APN 9 22490942 critical splice donor site probably null
IGL02172:Bbs9 APN 9 22579476 missense possibly damaging 0.65
IGL02212:Bbs9 APN 9 22812512 missense probably benign 0.02
IGL02444:Bbs9 APN 9 22643787 missense probably damaging 0.96
IGL02829:Bbs9 APN 9 22579484 missense probably damaging 0.98
IGL03385:Bbs9 APN 9 22643748 missense probably benign 0.19
corpulent UTSW 9 22575196 critical splice donor site probably null
Crapulence UTSW 9 22567764 missense probably damaging 1.00
R0038:Bbs9 UTSW 9 22504094 missense probably benign 0.30
R0243:Bbs9 UTSW 9 22514001 missense probably damaging 1.00
R0595:Bbs9 UTSW 9 22496815 missense probably benign
R0688:Bbs9 UTSW 9 22567719 missense probably damaging 0.98
R0726:Bbs9 UTSW 9 22793823 missense probably damaging 0.99
R0749:Bbs9 UTSW 9 22575201 splice site probably null
R0783:Bbs9 UTSW 9 22567714 missense possibly damaging 0.69
R1148:Bbs9 UTSW 9 22575100 splice site probably benign
R1532:Bbs9 UTSW 9 22887649 missense probably benign 0.00
R1783:Bbs9 UTSW 9 22659119 missense possibly damaging 0.85
R2285:Bbs9 UTSW 9 22678934 missense probably damaging 1.00
R2402:Bbs9 UTSW 9 22646063 missense probably benign 0.23
R2655:Bbs9 UTSW 9 22504052 missense probably damaging 1.00
R3428:Bbs9 UTSW 9 22567887 splice site probably benign
R3798:Bbs9 UTSW 9 22638769 missense probably damaging 1.00
R3806:Bbs9 UTSW 9 22887630 missense probably damaging 0.98
R4660:Bbs9 UTSW 9 22578767 missense probably benign 0.16
R4873:Bbs9 UTSW 9 22578715 missense probably benign 0.06
R4875:Bbs9 UTSW 9 22578715 missense probably benign 0.06
R5291:Bbs9 UTSW 9 22628997 missense probably damaging 1.00
R5364:Bbs9 UTSW 9 22575196 critical splice donor site probably null
R5502:Bbs9 UTSW 9 22504074 missense probably damaging 1.00
R5646:Bbs9 UTSW 9 22578715 missense probably benign 0.06
R5932:Bbs9 UTSW 9 22812331 missense probably damaging 1.00
R6222:Bbs9 UTSW 9 22567851 missense possibly damaging 0.88
R6451:Bbs9 UTSW 9 22567764 missense probably damaging 1.00
R6547:Bbs9 UTSW 9 22514069 missense probably benign 0.01
R6726:Bbs9 UTSW 9 22645964 missense probably benign 0.00
R6745:Bbs9 UTSW 9 22670836 missense probably benign 0.00
R6908:Bbs9 UTSW 9 22567723 missense probably damaging 0.96
R6919:Bbs9 UTSW 9 22812544 critical splice donor site probably null
R7102:Bbs9 UTSW 9 22579553 missense probably damaging 1.00
R7536:Bbs9 UTSW 9 22670800 missense probably damaging 1.00
R7712:Bbs9 UTSW 9 22670813 missense probably benign 0.34
R8177:Bbs9 UTSW 9 22514063 missense probably benign 0.08
R8241:Bbs9 UTSW 9 22678918 missense probably benign 0.00
R8440:Bbs9 UTSW 9 22567750 missense probably damaging 0.99
R8733:Bbs9 UTSW 9 22670832 missense probably benign 0.03
R8737:Bbs9 UTSW 9 22678948 missense probably benign 0.17
R8854:Bbs9 UTSW 9 22578764 missense probably damaging 1.00
R8885:Bbs9 UTSW 9 22678938 missense possibly damaging 0.67
X0027:Bbs9 UTSW 9 22655330 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTAGTCCTGAGCCAAGTC -3'
(R):5'- CTGTCCAGCATATGTCAGTGC -3'

Sequencing Primer
(F):5'- TAGTCCTGAGCCAAGTCCCATG -3'
(R):5'- AGCATATGTCAGTGCCCTGG -3'
Posted On2020-07-13