Incidental Mutation 'R8190:Zfyve26'
ID635102
Institutional Source Beutler Lab
Gene Symbol Zfyve26
Ensembl Gene ENSMUSG00000066440
Gene Namezinc finger, FYVE domain containing 26
SynonymsA630028O16Rik, LOC380767, 9330197E15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8190 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location79232346-79296304 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 79280836 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 580 (H580R)
Ref Sequence ENSEMBL: ENSMUSP00000021547 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021547]
Predicted Effect probably benign
Transcript: ENSMUST00000021547
AA Change: H580R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000021547
Gene: ENSMUSG00000066440
AA Change: H580R

DomainStartEndE-ValueType
low complexity region 8 24 N/A INTRINSIC
low complexity region 233 244 N/A INTRINSIC
low complexity region 752 775 N/A INTRINSIC
low complexity region 778 796 N/A INTRINSIC
low complexity region 982 1001 N/A INTRINSIC
low complexity region 1073 1091 N/A INTRINSIC
low complexity region 1104 1115 N/A INTRINSIC
low complexity region 1151 1163 N/A INTRINSIC
low complexity region 1177 1192 N/A INTRINSIC
low complexity region 1228 1241 N/A INTRINSIC
low complexity region 1565 1584 N/A INTRINSIC
low complexity region 1743 1770 N/A INTRINSIC
FYVE 1794 1863 1.49e-27 SMART
low complexity region 2486 2498 N/A INTRINSIC
low complexity region 2517 2528 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains a FYVE zinc finger binding domain. The presence of this domain is thought to target these proteins to membrane lipids through interaction with phospholipids in the membrane. Mutations in this gene are associated with autosomal recessive spastic paraplegia-15. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygoys for a null allele display a late-onset spastic gait disorder with cerebellar ataxia, axon degeneration, and progressive loss of cortical motoneurons and Purkinje cells preceded by accumulation of autofluorescent, electron-dense, membrane-enclosed material in lysosomal structures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr8 T C 14: 29,984,073 V113A possibly damaging Het
Adcy7 A G 8: 88,311,038 M245V possibly damaging Het
Adgra1 G T 7: 139,876,118 R554L probably benign Het
Agfg2 T A 5: 137,655,402 M351L probably benign Het
Ahnak G A 19: 9,002,255 G301D probably benign Het
Ambra1 C T 2: 91,772,352 A227V possibly damaging Het
Ankrd24 T A 10: 81,638,318 D166E unknown Het
Anks1 C T 17: 27,986,804 P341S probably benign Het
Ano4 C T 10: 88,972,745 D766N probably benign Het
Apol7e A T 15: 77,717,807 T202S possibly damaging Het
Arhgap44 C A 11: 65,038,653 C275F probably damaging Het
Arl6ip4 A C 5: 124,117,032 K95T probably damaging Het
Bbs9 T C 9: 22,678,988 L674P probably damaging Het
BC080695 T G 4: 143,571,960 Y158D probably benign Het
Bmp4 T A 14: 46,384,515 M191L probably benign Het
Celsr1 A G 15: 85,902,889 L2753P probably damaging Het
Cerkl T A 2: 79,333,557 H473L probably benign Het
Cfap99 A T 5: 34,325,158 T538S possibly damaging Het
Clock A T 5: 76,227,204 V706E probably damaging Het
Cpne6 T C 14: 55,512,028 M15T probably benign Het
Deaf1 T C 7: 141,314,411 D351G probably damaging Het
Dnajb8 C T 6: 88,222,958 R159C possibly damaging Het
Eif3j1 A T 2: 122,047,488 D119V probably damaging Het
Eps8l1 C A 7: 4,471,298 S195Y probably benign Het
Exosc5 T C 7: 25,666,344 probably null Het
Fabp2 A T 3: 122,896,770 H34L probably benign Het
Fam179b T C 12: 65,006,912 V1322A probably damaging Het
Fbln5 T A 12: 101,757,296 Q382L probably damaging Het
Fbxo34 C A 14: 47,530,422 T464K possibly damaging Het
Fndc8 T G 11: 82,897,860 V172G probably damaging Het
Frs2 C T 10: 117,074,879 V193I possibly damaging Het
Gadd45a A G 6: 67,036,829 I44T possibly damaging Het
Gprin3 A G 6: 59,354,471 S284P possibly damaging Het
Gsta4 T C 9: 78,198,372 V28A possibly damaging Het
Herc1 T A 9: 66,418,451 D1402E probably benign Het
Hipk2 A T 6: 38,818,793 S180R possibly damaging Het
Hrg A T 16: 22,961,043 H357L unknown Het
Htr4 A G 18: 62,437,900 Q342R possibly damaging Het
Impa1 A G 3: 10,321,628 S184P possibly damaging Het
Iqgap3 A T 3: 88,090,779 Q281L probably damaging Het
Kcnh8 C T 17: 52,956,908 P811L probably damaging Het
Lpin1 T C 12: 16,549,002 I628V Het
Lrrc38 G A 4: 143,350,733 G189R probably damaging Het
Mfn1 A T 3: 32,568,389 I599F possibly damaging Het
Nalcn T A 14: 123,599,939 R4S possibly damaging Het
Nbeal2 C T 9: 110,626,090 R2580Q probably benign Het
Nlrp4b A G 7: 10,714,392 N174S probably damaging Het
Olfr399 T A 11: 74,054,479 R93S probably benign Het
Olfr487 A G 7: 108,211,807 F241L possibly damaging Het
Olfr68 A T 7: 103,777,595 V250D probably damaging Het
Olfr735 A T 14: 50,345,722 V240D probably damaging Het
Pabpc2 G A 18: 39,775,467 R595Q probably benign Het
Pak6 C T 2: 118,690,097 Q190* probably null Het
Pds5a A T 5: 65,623,998 H1046Q probably damaging Het
Plin1 A G 7: 79,723,280 S314P probably benign Het
Ptpa G A 2: 30,438,339 S224N probably damaging Het
Rbp1 T G 9: 98,444,656 W107G probably damaging Het
Rgs7bp T C 13: 105,053,109 N61D probably damaging Het
Slc1a6 A G 10: 78,791,233 T135A probably damaging Het
Smarcc1 T A 9: 110,202,534 D783E probably benign Het
Sufu G T 19: 46,401,197 E86* probably null Het
Synm A T 7: 67,733,906 M1336K probably benign Het
Tgm1 C T 14: 55,704,884 G670D probably damaging Het
Tmc8 T G 11: 117,791,360 probably null Het
Uxs1 A T 1: 43,771,751 I225K possibly damaging Het
Vil1 G T 1: 74,434,893 E796* probably null Het
Vmn1r174 T C 7: 23,754,143 F78S probably damaging Het
Vps13d T A 4: 145,152,751 I1501F Het
Vps8 A T 16: 21,575,030 T1216S possibly damaging Het
Yipf4 G T 17: 74,493,972 R95L probably damaging Het
Zan T A 5: 137,467,084 T470S probably damaging Het
Zfp113 G T 5: 138,144,996 H331N probably damaging Het
Zfp62 A G 11: 49,216,075 Y331C probably damaging Het
Other mutations in Zfyve26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Zfyve26 APN 12 79249460 unclassified probably benign
IGL00940:Zfyve26 APN 12 79280900 missense probably benign
IGL01148:Zfyve26 APN 12 79260870 missense probably benign 0.01
IGL01347:Zfyve26 APN 12 79252183 splice site probably null
IGL01472:Zfyve26 APN 12 79276343 missense probably benign 0.01
IGL01490:Zfyve26 APN 12 79244373 missense probably damaging 1.00
IGL01516:Zfyve26 APN 12 79287851 missense probably benign 0.37
IGL01642:Zfyve26 APN 12 79261574 splice site probably null
IGL01689:Zfyve26 APN 12 79284053 missense possibly damaging 0.71
IGL01877:Zfyve26 APN 12 79287444 missense probably damaging 1.00
IGL01997:Zfyve26 APN 12 79244400 missense probably benign 0.00
IGL02077:Zfyve26 APN 12 79276395 missense possibly damaging 0.54
IGL02437:Zfyve26 APN 12 79268847 missense probably benign 0.01
IGL02933:Zfyve26 APN 12 79280080 missense possibly damaging 0.94
IGL02937:Zfyve26 APN 12 79239020 missense probably benign 0.08
IGL02982:Zfyve26 APN 12 79263870 missense probably damaging 0.99
IGL03064:Zfyve26 APN 12 79261791 missense probably damaging 1.00
IGL03086:Zfyve26 APN 12 79295564 missense probably damaging 0.96
IGL03146:Zfyve26 APN 12 79284072 nonsense probably null
IGL02799:Zfyve26 UTSW 12 79273310 missense probably benign 0.28
R0318:Zfyve26 UTSW 12 79276281 missense probably damaging 1.00
R0513:Zfyve26 UTSW 12 79244484 missense probably damaging 1.00
R0582:Zfyve26 UTSW 12 79246222 missense probably damaging 1.00
R0586:Zfyve26 UTSW 12 79268728 missense possibly damaging 0.96
R0718:Zfyve26 UTSW 12 79265802 splice site probably benign
R0738:Zfyve26 UTSW 12 79295534 missense probably damaging 1.00
R0781:Zfyve26 UTSW 12 79280067 missense probably damaging 0.99
R0894:Zfyve26 UTSW 12 79273598 missense possibly damaging 0.80
R1109:Zfyve26 UTSW 12 79272127 missense probably damaging 1.00
R1110:Zfyve26 UTSW 12 79280067 missense probably damaging 0.99
R1186:Zfyve26 UTSW 12 79263949 missense probably damaging 1.00
R1295:Zfyve26 UTSW 12 79274920 missense probably damaging 1.00
R1430:Zfyve26 UTSW 12 79282817 missense probably benign 0.07
R1439:Zfyve26 UTSW 12 79252163 missense probably benign 0.03
R1517:Zfyve26 UTSW 12 79252151 missense probably damaging 0.98
R1553:Zfyve26 UTSW 12 79287761 missense probably benign 0.00
R1721:Zfyve26 UTSW 12 79261799 missense possibly damaging 0.94
R1758:Zfyve26 UTSW 12 79238944 missense probably damaging 1.00
R1779:Zfyve26 UTSW 12 79278463 missense probably damaging 1.00
R1785:Zfyve26 UTSW 12 79268434 missense possibly damaging 0.48
R1786:Zfyve26 UTSW 12 79268434 missense possibly damaging 0.48
R1826:Zfyve26 UTSW 12 79269049 missense probably damaging 1.00
R1833:Zfyve26 UTSW 12 79286258 missense probably benign 0.36
R1868:Zfyve26 UTSW 12 79261799 missense possibly damaging 0.94
R1900:Zfyve26 UTSW 12 79264351 missense probably damaging 1.00
R1928:Zfyve26 UTSW 12 79239970 nonsense probably null
R1982:Zfyve26 UTSW 12 79255243 missense possibly damaging 0.55
R2062:Zfyve26 UTSW 12 79284032 splice site probably null
R2071:Zfyve26 UTSW 12 79287446 missense possibly damaging 0.95
R2130:Zfyve26 UTSW 12 79268434 missense possibly damaging 0.48
R2132:Zfyve26 UTSW 12 79268434 missense possibly damaging 0.48
R2133:Zfyve26 UTSW 12 79268434 missense possibly damaging 0.48
R2135:Zfyve26 UTSW 12 79246052 missense possibly damaging 0.80
R2207:Zfyve26 UTSW 12 79246087 missense probably damaging 0.99
R2280:Zfyve26 UTSW 12 79275040 missense probably damaging 1.00
R2352:Zfyve26 UTSW 12 79284116 missense probably damaging 1.00
R2398:Zfyve26 UTSW 12 79282799 splice site probably null
R3084:Zfyve26 UTSW 12 79265683 splice site probably benign
R3086:Zfyve26 UTSW 12 79265683 splice site probably benign
R4626:Zfyve26 UTSW 12 79269070 missense possibly damaging 0.95
R4727:Zfyve26 UTSW 12 79244396 missense probably benign 0.16
R4908:Zfyve26 UTSW 12 79249695 splice site probably null
R4926:Zfyve26 UTSW 12 79275011 missense probably benign
R4990:Zfyve26 UTSW 12 79287833 missense probably damaging 1.00
R4999:Zfyve26 UTSW 12 79280385 nonsense probably null
R5029:Zfyve26 UTSW 12 79286323 missense probably damaging 0.99
R5070:Zfyve26 UTSW 12 79255361 missense probably damaging 1.00
R5100:Zfyve26 UTSW 12 79280058 nonsense probably null
R5252:Zfyve26 UTSW 12 79268982 missense probably damaging 1.00
R5318:Zfyve26 UTSW 12 79270850 missense probably benign 0.35
R5509:Zfyve26 UTSW 12 79246521 missense probably damaging 1.00
R5574:Zfyve26 UTSW 12 79239924 missense possibly damaging 0.63
R5735:Zfyve26 UTSW 12 79273373 missense probably damaging 0.96
R5756:Zfyve26 UTSW 12 79264357 missense probably damaging 1.00
R5773:Zfyve26 UTSW 12 79287737 missense probably damaging 1.00
R5834:Zfyve26 UTSW 12 79266537 missense probably benign 0.30
R6075:Zfyve26 UTSW 12 79293854 missense possibly damaging 0.74
R6184:Zfyve26 UTSW 12 79268727 missense probably damaging 0.98
R6235:Zfyve26 UTSW 12 79249599 missense probably damaging 1.00
R6247:Zfyve26 UTSW 12 79282984 missense probably benign 0.04
R6320:Zfyve26 UTSW 12 79240002 missense probably damaging 0.97
R6548:Zfyve26 UTSW 12 79238335 missense probably damaging 1.00
R6887:Zfyve26 UTSW 12 79266449 missense probably damaging 1.00
R7133:Zfyve26 UTSW 12 79284152 missense probably benign 0.06
R7152:Zfyve26 UTSW 12 79279114 missense probably benign 0.42
R7165:Zfyve26 UTSW 12 79280405 missense probably damaging 1.00
R7181:Zfyve26 UTSW 12 79268408 missense probably benign 0.00
R7223:Zfyve26 UTSW 12 79246171 missense probably damaging 0.99
R7296:Zfyve26 UTSW 12 79278372 splice site probably null
R7299:Zfyve26 UTSW 12 79282984 missense probably benign 0.01
R7301:Zfyve26 UTSW 12 79282984 missense probably benign 0.01
R7302:Zfyve26 UTSW 12 79251168 missense probably damaging 1.00
R7355:Zfyve26 UTSW 12 79240054 missense probably damaging 1.00
R7466:Zfyve26 UTSW 12 79287807 missense probably benign 0.00
R7540:Zfyve26 UTSW 12 79268676 missense probably damaging 0.99
R7552:Zfyve26 UTSW 12 79290957 missense probably damaging 0.97
R7762:Zfyve26 UTSW 12 79268635 missense probably benign 0.02
R7806:Zfyve26 UTSW 12 79280355 critical splice donor site probably null
R7821:Zfyve26 UTSW 12 79255324 missense probably damaging 1.00
R8141:Zfyve26 UTSW 12 79268557 missense possibly damaging 0.79
R8207:Zfyve26 UTSW 12 79260831 missense probably damaging 1.00
R8210:Zfyve26 UTSW 12 79255263 missense probably damaging 1.00
R8500:Zfyve26 UTSW 12 79287680 missense probably damaging 0.99
R8686:Zfyve26 UTSW 12 79287453 missense probably benign
R8758:Zfyve26 UTSW 12 79264309 critical splice donor site probably benign
R8826:Zfyve26 UTSW 12 79238968 missense probably benign 0.05
R8877:Zfyve26 UTSW 12 79287378 missense probably benign 0.05
RF010:Zfyve26 UTSW 12 79255338 missense probably damaging 1.00
X0020:Zfyve26 UTSW 12 79239005 missense probably damaging 1.00
Z1176:Zfyve26 UTSW 12 79268533 missense probably benign 0.07
Z1177:Zfyve26 UTSW 12 79287375 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- TGAACTGTCTTTCGGCTCTG -3'
(R):5'- GAAGCATGGCATTGTTCAGTG -3'

Sequencing Primer
(F):5'- TCTGCCTTTGGACAGCCG -3'
(R):5'- CAGTGGCTCTGCTTTCTCAGG -3'
Posted On2020-07-13