Incidental Mutation 'R8190:Fbln5'
ID635103
Institutional Source Beutler Lab
Gene Symbol Fbln5
Ensembl Gene ENSMUSG00000021186
Gene Namefibulin 5
SynonymsEVEC
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.185) question?
Stock #R8190 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location101746565-101819055 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 101757296 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 382 (Q382L)
Ref Sequence ENSEMBL: ENSMUSP00000021603 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021603]
Predicted Effect probably damaging
Transcript: ENSMUST00000021603
AA Change: Q382L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000021603
Gene: ENSMUSG00000021186
AA Change: Q382L

DomainStartEndE-ValueType
EGF_like 42 86 4.71e-1 SMART
EGF_CA 127 167 4.81e-8 SMART
EGF_CA 168 206 2.31e-10 SMART
EGF_CA 207 246 5.31e-10 SMART
EGF_CA 247 287 2.22e-12 SMART
EGF_like 288 333 8.14e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a secreted, extracellular matrix protein containing an Arg-Gly-Asp (RGD) motif and calcium-binding EGF-like domains. It promotes adhesion of endothelial cells through interaction of integrins and the RGD motif. It is prominently expressed in developing arteries but less so in adult vessels. However, its expression is reinduced in balloon-injured vessels and atherosclerotic lesions, notably in intimal vascular smooth muscle cells and endothelial cells. Therefore, the protein encoded by this gene may play a role in vascular development and remodeling. Defects in this gene are a cause of autosomal dominant cutis laxa, autosomal recessive cutis laxa type I (CL type I), and age-related macular degeneration type 3 (ARMD3). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this locus impairs elastic fiber development. Mutant mice exhibit loose skin, lung abnormalities leading to emphysema, and cardiovascular defects affecting the aorta. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr8 T C 14: 29,984,073 V113A possibly damaging Het
Adcy7 A G 8: 88,311,038 M245V possibly damaging Het
Adgra1 G T 7: 139,876,118 R554L probably benign Het
Agfg2 T A 5: 137,655,402 M351L probably benign Het
Ahnak G A 19: 9,002,255 G301D probably benign Het
Ambra1 C T 2: 91,772,352 A227V possibly damaging Het
Ankrd24 T A 10: 81,638,318 D166E unknown Het
Anks1 C T 17: 27,986,804 P341S probably benign Het
Ano4 C T 10: 88,972,745 D766N probably benign Het
Apol7e A T 15: 77,717,807 T202S possibly damaging Het
Arhgap44 C A 11: 65,038,653 C275F probably damaging Het
Arl6ip4 A C 5: 124,117,032 K95T probably damaging Het
Bbs9 T C 9: 22,678,988 L674P probably damaging Het
BC080695 T G 4: 143,571,960 Y158D probably benign Het
Bmp4 T A 14: 46,384,515 M191L probably benign Het
Celsr1 A G 15: 85,902,889 L2753P probably damaging Het
Cerkl T A 2: 79,333,557 H473L probably benign Het
Cfap99 A T 5: 34,325,158 T538S possibly damaging Het
Clock A T 5: 76,227,204 V706E probably damaging Het
Cpne6 T C 14: 55,512,028 M15T probably benign Het
Deaf1 T C 7: 141,314,411 D351G probably damaging Het
Dnajb8 C T 6: 88,222,958 R159C possibly damaging Het
Eif3j1 A T 2: 122,047,488 D119V probably damaging Het
Eps8l1 C A 7: 4,471,298 S195Y probably benign Het
Exosc5 T C 7: 25,666,344 probably null Het
Fabp2 A T 3: 122,896,770 H34L probably benign Het
Fam179b T C 12: 65,006,912 V1322A probably damaging Het
Fbxo34 C A 14: 47,530,422 T464K possibly damaging Het
Fndc8 T G 11: 82,897,860 V172G probably damaging Het
Frs2 C T 10: 117,074,879 V193I possibly damaging Het
Gadd45a A G 6: 67,036,829 I44T possibly damaging Het
Gprin3 A G 6: 59,354,471 S284P possibly damaging Het
Gsta4 T C 9: 78,198,372 V28A possibly damaging Het
Herc1 T A 9: 66,418,451 D1402E probably benign Het
Hipk2 A T 6: 38,818,793 S180R possibly damaging Het
Hrg A T 16: 22,961,043 H357L unknown Het
Htr4 A G 18: 62,437,900 Q342R possibly damaging Het
Impa1 A G 3: 10,321,628 S184P possibly damaging Het
Iqgap3 A T 3: 88,090,779 Q281L probably damaging Het
Kcnh8 C T 17: 52,956,908 P811L probably damaging Het
Lpin1 T C 12: 16,549,002 I628V Het
Lrrc38 G A 4: 143,350,733 G189R probably damaging Het
Mfn1 A T 3: 32,568,389 I599F possibly damaging Het
Nalcn T A 14: 123,599,939 R4S possibly damaging Het
Nbeal2 C T 9: 110,626,090 R2580Q probably benign Het
Nlrp4b A G 7: 10,714,392 N174S probably damaging Het
Olfr399 T A 11: 74,054,479 R93S probably benign Het
Olfr487 A G 7: 108,211,807 F241L possibly damaging Het
Olfr68 A T 7: 103,777,595 V250D probably damaging Het
Olfr735 A T 14: 50,345,722 V240D probably damaging Het
Pabpc2 G A 18: 39,775,467 R595Q probably benign Het
Pak6 C T 2: 118,690,097 Q190* probably null Het
Pds5a A T 5: 65,623,998 H1046Q probably damaging Het
Plin1 A G 7: 79,723,280 S314P probably benign Het
Ptpa G A 2: 30,438,339 S224N probably damaging Het
Rbp1 T G 9: 98,444,656 W107G probably damaging Het
Rgs7bp T C 13: 105,053,109 N61D probably damaging Het
Slc1a6 A G 10: 78,791,233 T135A probably damaging Het
Smarcc1 T A 9: 110,202,534 D783E probably benign Het
Sufu G T 19: 46,401,197 E86* probably null Het
Synm A T 7: 67,733,906 M1336K probably benign Het
Tgm1 C T 14: 55,704,884 G670D probably damaging Het
Tmc8 T G 11: 117,791,360 probably null Het
Uxs1 A T 1: 43,771,751 I225K possibly damaging Het
Vil1 G T 1: 74,434,893 E796* probably null Het
Vmn1r174 T C 7: 23,754,143 F78S probably damaging Het
Vps13d T A 4: 145,152,751 I1501F Het
Vps8 A T 16: 21,575,030 T1216S possibly damaging Het
Yipf4 G T 17: 74,493,972 R95L probably damaging Het
Zan T A 5: 137,467,084 T470S probably damaging Het
Zfp113 G T 5: 138,144,996 H331N probably damaging Het
Zfp62 A G 11: 49,216,075 Y331C probably damaging Het
Zfyve26 T C 12: 79,280,836 H580R probably benign Het
Other mutations in Fbln5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00863:Fbln5 APN 12 101809916 missense probably damaging 0.98
IGL01357:Fbln5 APN 12 101750887 missense probably damaging 1.00
IGL01860:Fbln5 APN 12 101809869 missense probably damaging 1.00
IGL02567:Fbln5 APN 12 101761800 critical splice donor site probably null
BB004:Fbln5 UTSW 12 101818388 start gained probably benign
BB014:Fbln5 UTSW 12 101818388 start gained probably benign
R0368:Fbln5 UTSW 12 101809714 critical splice donor site probably null
R1080:Fbln5 UTSW 12 101750872 missense possibly damaging 0.90
R1606:Fbln5 UTSW 12 101765198 missense probably benign 0.04
R2107:Fbln5 UTSW 12 101771269 missense probably damaging 1.00
R2138:Fbln5 UTSW 12 101761920 missense probably benign 0.32
R3694:Fbln5 UTSW 12 101765252 missense probably benign 0.00
R3918:Fbln5 UTSW 12 101750791 missense probably damaging 1.00
R4166:Fbln5 UTSW 12 101757359 missense probably damaging 1.00
R4626:Fbln5 UTSW 12 101760827 missense probably damaging 1.00
R5004:Fbln5 UTSW 12 101760821 missense probably damaging 0.99
R5264:Fbln5 UTSW 12 101757444 missense possibly damaging 0.94
R5364:Fbln5 UTSW 12 101771364 missense probably damaging 0.98
R5767:Fbln5 UTSW 12 101765209 missense probably damaging 0.97
R5889:Fbln5 UTSW 12 101765226 missense probably damaging 1.00
R5914:Fbln5 UTSW 12 101760743 missense possibly damaging 0.78
R6427:Fbln5 UTSW 12 101761822 missense possibly damaging 0.84
R7079:Fbln5 UTSW 12 101757408 missense probably damaging 1.00
R7343:Fbln5 UTSW 12 101760816 missense probably damaging 1.00
R7803:Fbln5 UTSW 12 101761818 missense probably damaging 1.00
R7927:Fbln5 UTSW 12 101818388 start gained probably benign
R8381:Fbln5 UTSW 12 101761855 missense probably benign
R8747:Fbln5 UTSW 12 101768495 missense probably damaging 1.00
R8857:Fbln5 UTSW 12 101760731 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACATTGATCTTTGGCCTTGAC -3'
(R):5'- TGCCTGGAAACTCATATGGTTTC -3'

Sequencing Primer
(F):5'- GACATGTGTTCACTCTCGAGAATGC -3'
(R):5'- GGAAACTCATATGGTTTCTCTCCTG -3'
Posted On2020-07-13