Incidental Mutation 'R8190:Rgs7bp'
ID635104
Institutional Source Beutler Lab
Gene Symbol Rgs7bp
Ensembl Gene ENSMUSG00000021719
Gene Nameregulator of G-protein signalling 7 binding protein
SynonymsD13Bwg1146e, R7bp, A930030I01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8190 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location104945904-105054930 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 105053109 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 61 (N61D)
Ref Sequence ENSEMBL: ENSMUSP00000066614 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063551]
Predicted Effect probably damaging
Transcript: ENSMUST00000063551
AA Change: N61D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000066614
Gene: ENSMUSG00000021719
AA Change: N61D

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
coiled coil region 194 221 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that binds to all members of the R7 subfamily of regulators of G protein signaling and regulates their translocation between the nucleus and the plasma membrane. The encoded protein could be regulated by reversible palmitoylation, which anchors it to the plasma membrane. Depalmitoylation localizes the protein to the nucleus. Polymorphisms in this gene may be associated with risk of aspirin-exacerbated respiratory disease. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit normal behavior and brain morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr8 T C 14: 29,984,073 V113A possibly damaging Het
Adcy7 A G 8: 88,311,038 M245V possibly damaging Het
Adgra1 G T 7: 139,876,118 R554L probably benign Het
Agfg2 T A 5: 137,655,402 M351L probably benign Het
Ahnak G A 19: 9,002,255 G301D probably benign Het
Ambra1 C T 2: 91,772,352 A227V possibly damaging Het
Ankrd24 T A 10: 81,638,318 D166E unknown Het
Anks1 C T 17: 27,986,804 P341S probably benign Het
Ano4 C T 10: 88,972,745 D766N probably benign Het
Apol7e A T 15: 77,717,807 T202S possibly damaging Het
Arhgap44 C A 11: 65,038,653 C275F probably damaging Het
Arl6ip4 A C 5: 124,117,032 K95T probably damaging Het
Bbs9 T C 9: 22,678,988 L674P probably damaging Het
BC080695 T G 4: 143,571,960 Y158D probably benign Het
Bmp4 T A 14: 46,384,515 M191L probably benign Het
Celsr1 A G 15: 85,902,889 L2753P probably damaging Het
Cerkl T A 2: 79,333,557 H473L probably benign Het
Cfap99 A T 5: 34,325,158 T538S possibly damaging Het
Clock A T 5: 76,227,204 V706E probably damaging Het
Cpne6 T C 14: 55,512,028 M15T probably benign Het
Deaf1 T C 7: 141,314,411 D351G probably damaging Het
Dnajb8 C T 6: 88,222,958 R159C possibly damaging Het
Eif3j1 A T 2: 122,047,488 D119V probably damaging Het
Eps8l1 C A 7: 4,471,298 S195Y probably benign Het
Exosc5 T C 7: 25,666,344 probably null Het
Fabp2 A T 3: 122,896,770 H34L probably benign Het
Fam179b T C 12: 65,006,912 V1322A probably damaging Het
Fbln5 T A 12: 101,757,296 Q382L probably damaging Het
Fbxo34 C A 14: 47,530,422 T464K possibly damaging Het
Fndc8 T G 11: 82,897,860 V172G probably damaging Het
Frs2 C T 10: 117,074,879 V193I possibly damaging Het
Gadd45a A G 6: 67,036,829 I44T possibly damaging Het
Gprin3 A G 6: 59,354,471 S284P possibly damaging Het
Gsta4 T C 9: 78,198,372 V28A possibly damaging Het
Herc1 T A 9: 66,418,451 D1402E probably benign Het
Hipk2 A T 6: 38,818,793 S180R possibly damaging Het
Hrg A T 16: 22,961,043 H357L unknown Het
Htr4 A G 18: 62,437,900 Q342R possibly damaging Het
Impa1 A G 3: 10,321,628 S184P possibly damaging Het
Iqgap3 A T 3: 88,090,779 Q281L probably damaging Het
Kcnh8 C T 17: 52,956,908 P811L probably damaging Het
Lpin1 T C 12: 16,549,002 I628V Het
Lrrc38 G A 4: 143,350,733 G189R probably damaging Het
Mfn1 A T 3: 32,568,389 I599F possibly damaging Het
Nalcn T A 14: 123,599,939 R4S possibly damaging Het
Nbeal2 C T 9: 110,626,090 R2580Q probably benign Het
Nlrp4b A G 7: 10,714,392 N174S probably damaging Het
Olfr399 T A 11: 74,054,479 R93S probably benign Het
Olfr487 A G 7: 108,211,807 F241L possibly damaging Het
Olfr68 A T 7: 103,777,595 V250D probably damaging Het
Olfr735 A T 14: 50,345,722 V240D probably damaging Het
Pabpc2 G A 18: 39,775,467 R595Q probably benign Het
Pak6 C T 2: 118,690,097 Q190* probably null Het
Pds5a A T 5: 65,623,998 H1046Q probably damaging Het
Plin1 A G 7: 79,723,280 S314P probably benign Het
Ptpa G A 2: 30,438,339 S224N probably damaging Het
Rbp1 T G 9: 98,444,656 W107G probably damaging Het
Slc1a6 A G 10: 78,791,233 T135A probably damaging Het
Smarcc1 T A 9: 110,202,534 D783E probably benign Het
Sufu G T 19: 46,401,197 E86* probably null Het
Synm A T 7: 67,733,906 M1336K probably benign Het
Tgm1 C T 14: 55,704,884 G670D probably damaging Het
Tmc8 T G 11: 117,791,360 probably null Het
Uxs1 A T 1: 43,771,751 I225K possibly damaging Het
Vil1 G T 1: 74,434,893 E796* probably null Het
Vmn1r174 T C 7: 23,754,143 F78S probably damaging Het
Vps13d T A 4: 145,152,751 I1501F Het
Vps8 A T 16: 21,575,030 T1216S possibly damaging Het
Yipf4 G T 17: 74,493,972 R95L probably damaging Het
Zan T A 5: 137,467,084 T470S probably damaging Het
Zfp113 G T 5: 138,144,996 H331N probably damaging Het
Zfp62 A G 11: 49,216,075 Y331C probably damaging Het
Zfyve26 T C 12: 79,280,836 H580R probably benign Het
Other mutations in Rgs7bp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02117:Rgs7bp APN 13 104951579 missense possibly damaging 0.92
R0607:Rgs7bp UTSW 13 104967102 missense probably benign 0.02
R1938:Rgs7bp UTSW 13 104951582 missense probably damaging 1.00
R2151:Rgs7bp UTSW 13 104964089 missense probably damaging 1.00
R3932:Rgs7bp UTSW 13 105052998 missense probably benign 0.00
R3933:Rgs7bp UTSW 13 105052998 missense probably benign 0.00
R4686:Rgs7bp UTSW 13 104964089 missense probably damaging 1.00
R4828:Rgs7bp UTSW 13 105053024 missense possibly damaging 0.59
R4944:Rgs7bp UTSW 13 104951564 missense probably benign 0.29
R7181:Rgs7bp UTSW 13 104982874 missense possibly damaging 0.85
R7786:Rgs7bp UTSW 13 105054060 missense probably benign 0.01
R8118:Rgs7bp UTSW 13 105053121 missense probably damaging 1.00
R8481:Rgs7bp UTSW 13 105054208 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCACCACAGAATTTTGCC -3'
(R):5'- GACTTTGCCATCCTTGTACCTTAAG -3'

Sequencing Primer
(F):5'- ATTTTGCCAGCATCCACACATCATG -3'
(R):5'- AGCTTTAAACAGTTCTAAAGCTCC -3'
Posted On2020-07-13