Incidental Mutation 'R8190:Nalcn'
ID635111
Institutional Source Beutler Lab
Gene Symbol Nalcn
Ensembl Gene ENSMUSG00000000197
Gene Namesodium leak channel, non-selective
SynonymsA530023G15Rik, Vgcnl1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8190 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location123276634-123627144 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 123599939 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 4 (R4S)
Ref Sequence ENSEMBL: ENSMUSP00000000201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000201]
Predicted Effect possibly damaging
Transcript: ENSMUST00000000201
AA Change: R4S

PolyPhen 2 Score 0.692 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000000201
Gene: ENSMUSG00000000197
AA Change: R4S

DomainStartEndE-ValueType
Pfam:Ion_trans 35 333 2.8e-37 PFAM
low complexity region 338 348 N/A INTRINSIC
Pfam:Ion_trans 383 609 5.7e-34 PFAM
coiled coil region 796 830 N/A INTRINSIC
Pfam:Ion_trans 885 1166 2.4e-42 PFAM
Pfam:Ion_trans 1209 1458 6.9e-30 PFAM
low complexity region 1548 1560 N/A INTRINSIC
low complexity region 1634 1649 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NALCN forms a voltage-independent, nonselective, noninactivating cation channel permeable to Na+, K+, and Ca(2+). It is responsible for the neuronal background sodium leak conductance (Lu et al., 2007 [PubMed 17448995]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal breathing at birth and die within 24 hours. Mice homozygous for a gain of function ENU mutation exhibit reduced the total amount and episode duration of REMS. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr8 T C 14: 29,984,073 V113A possibly damaging Het
Adcy7 A G 8: 88,311,038 M245V possibly damaging Het
Adgra1 G T 7: 139,876,118 R554L probably benign Het
Agfg2 T A 5: 137,655,402 M351L probably benign Het
Ahnak G A 19: 9,002,255 G301D probably benign Het
Ambra1 C T 2: 91,772,352 A227V possibly damaging Het
Ankrd24 T A 10: 81,638,318 D166E unknown Het
Anks1 C T 17: 27,986,804 P341S probably benign Het
Ano4 C T 10: 88,972,745 D766N probably benign Het
Apol7e A T 15: 77,717,807 T202S possibly damaging Het
Arhgap44 C A 11: 65,038,653 C275F probably damaging Het
Arl6ip4 A C 5: 124,117,032 K95T probably damaging Het
Bbs9 T C 9: 22,678,988 L674P probably damaging Het
BC080695 T G 4: 143,571,960 Y158D probably benign Het
Bmp4 T A 14: 46,384,515 M191L probably benign Het
Celsr1 A G 15: 85,902,889 L2753P probably damaging Het
Cerkl T A 2: 79,333,557 H473L probably benign Het
Cfap99 A T 5: 34,325,158 T538S possibly damaging Het
Clock A T 5: 76,227,204 V706E probably damaging Het
Cpne6 T C 14: 55,512,028 M15T probably benign Het
Deaf1 T C 7: 141,314,411 D351G probably damaging Het
Dnajb8 C T 6: 88,222,958 R159C possibly damaging Het
Eif3j1 A T 2: 122,047,488 D119V probably damaging Het
Eps8l1 C A 7: 4,471,298 S195Y probably benign Het
Exosc5 T C 7: 25,666,344 probably null Het
Fabp2 A T 3: 122,896,770 H34L probably benign Het
Fam179b T C 12: 65,006,912 V1322A probably damaging Het
Fbln5 T A 12: 101,757,296 Q382L probably damaging Het
Fbxo34 C A 14: 47,530,422 T464K possibly damaging Het
Fndc8 T G 11: 82,897,860 V172G probably damaging Het
Frs2 C T 10: 117,074,879 V193I possibly damaging Het
Gadd45a A G 6: 67,036,829 I44T possibly damaging Het
Gprin3 A G 6: 59,354,471 S284P possibly damaging Het
Gsta4 T C 9: 78,198,372 V28A possibly damaging Het
Herc1 T A 9: 66,418,451 D1402E probably benign Het
Hipk2 A T 6: 38,818,793 S180R possibly damaging Het
Hrg A T 16: 22,961,043 H357L unknown Het
Htr4 A G 18: 62,437,900 Q342R possibly damaging Het
Impa1 A G 3: 10,321,628 S184P possibly damaging Het
Iqgap3 A T 3: 88,090,779 Q281L probably damaging Het
Kcnh8 C T 17: 52,956,908 P811L probably damaging Het
Lpin1 T C 12: 16,549,002 I628V Het
Lrrc38 G A 4: 143,350,733 G189R probably damaging Het
Mfn1 A T 3: 32,568,389 I599F possibly damaging Het
Nbeal2 C T 9: 110,626,090 R2580Q probably benign Het
Nlrp4b A G 7: 10,714,392 N174S probably damaging Het
Olfr399 T A 11: 74,054,479 R93S probably benign Het
Olfr487 A G 7: 108,211,807 F241L possibly damaging Het
Olfr68 A T 7: 103,777,595 V250D probably damaging Het
Olfr735 A T 14: 50,345,722 V240D probably damaging Het
Pabpc2 G A 18: 39,775,467 R595Q probably benign Het
Pak6 C T 2: 118,690,097 Q190* probably null Het
Pds5a A T 5: 65,623,998 H1046Q probably damaging Het
Plin1 A G 7: 79,723,280 S314P probably benign Het
Ptpa G A 2: 30,438,339 S224N probably damaging Het
Rbp1 T G 9: 98,444,656 W107G probably damaging Het
Rgs7bp T C 13: 105,053,109 N61D probably damaging Het
Slc1a6 A G 10: 78,791,233 T135A probably damaging Het
Smarcc1 T A 9: 110,202,534 D783E probably benign Het
Sufu G T 19: 46,401,197 E86* probably null Het
Synm A T 7: 67,733,906 M1336K probably benign Het
Tgm1 C T 14: 55,704,884 G670D probably damaging Het
Tmc8 T G 11: 117,791,360 probably null Het
Uxs1 A T 1: 43,771,751 I225K possibly damaging Het
Vil1 G T 1: 74,434,893 E796* probably null Het
Vmn1r174 T C 7: 23,754,143 F78S probably damaging Het
Vps13d T A 4: 145,152,751 I1501F Het
Vps8 A T 16: 21,575,030 T1216S possibly damaging Het
Yipf4 G T 17: 74,493,972 R95L probably damaging Het
Zan T A 5: 137,467,084 T470S probably damaging Het
Zfp113 G T 5: 138,144,996 H331N probably damaging Het
Zfp62 A G 11: 49,216,075 Y331C probably damaging Het
Zfyve26 T C 12: 79,280,836 H580R probably benign Het
Other mutations in Nalcn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Nalcn APN 14 123348789 missense probably benign 0.00
IGL00964:Nalcn APN 14 123295384 splice site probably benign
IGL01310:Nalcn APN 14 123317249 missense probably benign 0.00
IGL01578:Nalcn APN 14 123572091 missense probably benign 0.00
IGL01925:Nalcn APN 14 123291848 missense possibly damaging 0.88
IGL02072:Nalcn APN 14 123323358 missense probably benign 0.05
IGL02096:Nalcn APN 14 123594503 missense probably benign 0.11
IGL02212:Nalcn APN 14 123515330 missense probably damaging 0.99
IGL02306:Nalcn APN 14 123323338 missense probably benign 0.07
IGL02471:Nalcn APN 14 123323314 missense probably benign 0.02
IGL02478:Nalcn APN 14 123321305 missense probably benign 0.26
IGL02551:Nalcn APN 14 123323338 missense probably benign 0.07
IGL02630:Nalcn APN 14 123317879 missense probably benign 0.16
IGL02632:Nalcn APN 14 123317853 missense probably benign 0.11
IGL02661:Nalcn APN 14 123592909 splice site probably benign
IGL02830:Nalcn APN 14 123293469 missense probably damaging 0.98
IGL02939:Nalcn APN 14 123298872 missense probably null 1.00
IGL03035:Nalcn APN 14 123278218 nonsense probably null
IGL03226:Nalcn APN 14 123281115 missense probably benign 0.00
IGL03242:Nalcn APN 14 123321487 missense possibly damaging 0.91
Narnia UTSW 14 123291047 missense probably benign 0.11
R0019:Nalcn UTSW 14 123507489 missense probably benign 0.18
R0144:Nalcn UTSW 14 123371536 missense probably damaging 0.96
R0144:Nalcn UTSW 14 123409839 splice site probably benign
R0359:Nalcn UTSW 14 123299168 missense probably damaging 1.00
R0383:Nalcn UTSW 14 123507559 missense probably benign 0.01
R0400:Nalcn UTSW 14 123290960 splice site probably benign
R0467:Nalcn UTSW 14 123291047 missense probably benign 0.11
R0506:Nalcn UTSW 14 123596614 missense possibly damaging 0.82
R0583:Nalcn UTSW 14 123294343 missense possibly damaging 0.46
R0620:Nalcn UTSW 14 123299141 splice site probably benign
R0624:Nalcn UTSW 14 123370032 missense probably benign
R0883:Nalcn UTSW 14 123464740 missense probably damaging 1.00
R1381:Nalcn UTSW 14 123314105 missense probably damaging 1.00
R1467:Nalcn UTSW 14 123464656 splice site probably benign
R1689:Nalcn UTSW 14 123285254 missense probably damaging 1.00
R1726:Nalcn UTSW 14 123308404 missense probably damaging 1.00
R1774:Nalcn UTSW 14 123278266 missense probably benign
R1854:Nalcn UTSW 14 123460412 missense probably damaging 1.00
R1869:Nalcn UTSW 14 123594553 missense possibly damaging 0.96
R1871:Nalcn UTSW 14 123594553 missense possibly damaging 0.96
R1873:Nalcn UTSW 14 123283601 missense probably benign 0.00
R1899:Nalcn UTSW 14 123316126 missense possibly damaging 0.50
R1915:Nalcn UTSW 14 123302769 missense probably benign 0.08
R2016:Nalcn UTSW 14 123594581 splice site probably null
R2034:Nalcn UTSW 14 123283603 missense probably benign 0.01
R2087:Nalcn UTSW 14 123281145 missense probably benign
R2149:Nalcn UTSW 14 123370017 missense probably benign 0.01
R2157:Nalcn UTSW 14 123409752 missense probably benign 0.32
R2166:Nalcn UTSW 14 123369951 missense probably benign 0.00
R2932:Nalcn UTSW 14 123593018 missense probably benign 0.06
R3408:Nalcn UTSW 14 123596617 missense probably null 0.98
R3778:Nalcn UTSW 14 123464716 missense probably damaging 1.00
R3807:Nalcn UTSW 14 123278187 missense probably damaging 1.00
R3835:Nalcn UTSW 14 123293422 splice site probably benign
R3937:Nalcn UTSW 14 123369945 missense probably benign 0.00
R4001:Nalcn UTSW 14 123596594 missense probably damaging 1.00
R4015:Nalcn UTSW 14 123486387 missense probably damaging 1.00
R4033:Nalcn UTSW 14 123599989 splice site probably benign
R4231:Nalcn UTSW 14 123599913 missense probably benign 0.01
R4464:Nalcn UTSW 14 123323350 missense probably benign
R4512:Nalcn UTSW 14 123295448 missense probably damaging 1.00
R4542:Nalcn UTSW 14 123321477 synonymous silent
R4557:Nalcn UTSW 14 123321235 intron probably benign
R4869:Nalcn UTSW 14 123599884 missense probably benign 0.44
R5083:Nalcn UTSW 14 123323294 splice site probably null
R5109:Nalcn UTSW 14 123278238 missense possibly damaging 0.86
R5131:Nalcn UTSW 14 123515770 missense probably damaging 0.98
R5158:Nalcn UTSW 14 123515737 missense probably damaging 1.00
R5259:Nalcn UTSW 14 123515651 missense possibly damaging 0.94
R5422:Nalcn UTSW 14 123515365 missense probably damaging 1.00
R5514:Nalcn UTSW 14 123283711 missense probably benign 0.14
R5523:Nalcn UTSW 14 123409743 missense probably damaging 1.00
R5551:Nalcn UTSW 14 123278286 missense possibly damaging 0.57
R5667:Nalcn UTSW 14 123295406 missense probably damaging 1.00
R5671:Nalcn UTSW 14 123295406 missense probably damaging 1.00
R5750:Nalcn UTSW 14 123572038 missense probably benign
R5765:Nalcn UTSW 14 123464726 missense possibly damaging 0.46
R6324:Nalcn UTSW 14 123409749 missense possibly damaging 0.83
R6523:Nalcn UTSW 14 123317843 missense probably benign 0.00
R6558:Nalcn UTSW 14 123486507 missense probably benign
R6631:Nalcn UTSW 14 123460251 missense probably benign 0.17
R6667:Nalcn UTSW 14 123321323 missense probably damaging 1.00
R6670:Nalcn UTSW 14 123464672 missense possibly damaging 0.96
R6724:Nalcn UTSW 14 123298067 missense probably damaging 0.99
R6731:Nalcn UTSW 14 123599934 missense probably benign 0.22
R6957:Nalcn UTSW 14 123507554 missense probably damaging 0.96
R6970:Nalcn UTSW 14 123314094 missense possibly damaging 0.46
R7010:Nalcn UTSW 14 123293465 missense probably damaging 1.00
R7018:Nalcn UTSW 14 123409821 missense probably damaging 1.00
R7040:Nalcn UTSW 14 123287855 missense probably benign
R7089:Nalcn UTSW 14 123278349 missense probably benign 0.01
R7128:Nalcn UTSW 14 123594502 missense probably damaging 0.99
R7149:Nalcn UTSW 14 123599865 missense probably benign 0.02
R7361:Nalcn UTSW 14 123291839 missense probably benign 0.00
R7378:Nalcn UTSW 14 123302890 missense probably damaging 1.00
R7408:Nalcn UTSW 14 123291860 missense probably benign 0.00
R7470:Nalcn UTSW 14 123572044 missense probably benign 0.09
R7483:Nalcn UTSW 14 123314087 missense probably damaging 1.00
R7521:Nalcn UTSW 14 123293458 missense probably damaging 1.00
R7558:Nalcn UTSW 14 123486385 critical splice donor site probably null
R7585:Nalcn UTSW 14 123515638 missense probably damaging 1.00
R7591:Nalcn UTSW 14 123323885 missense probably benign 0.01
R7761:Nalcn UTSW 14 123294379 missense probably damaging 1.00
R7761:Nalcn UTSW 14 123294380 missense probably damaging 1.00
R7811:Nalcn UTSW 14 123298945 missense probably damaging 1.00
R7983:Nalcn UTSW 14 123592997 missense probably benign 0.17
R8089:Nalcn UTSW 14 123299960 missense probably damaging 1.00
R8110:Nalcn UTSW 14 123464701 missense probably benign 0.00
R8273:Nalcn UTSW 14 123317024 missense probably damaging 1.00
R8407:Nalcn UTSW 14 123317271 missense probably damaging 1.00
R8497:Nalcn UTSW 14 123515359 missense probably damaging 1.00
R8544:Nalcn UTSW 14 123371523 missense probably benign 0.40
R8549:Nalcn UTSW 14 123370036 missense probably benign 0.01
R8731:Nalcn UTSW 14 123599854 missense probably benign 0.01
R8862:Nalcn UTSW 14 123409787 missense possibly damaging 0.96
R8919:Nalcn UTSW 14 123323872 missense probably benign 0.00
X0060:Nalcn UTSW 14 123285241 missense probably damaging 1.00
Z1177:Nalcn UTSW 14 123294445 missense probably damaging 1.00
Z1177:Nalcn UTSW 14 123594568 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACTCCAGGACTCATTCAATTTCC -3'
(R):5'- GTCACATACAGTACCATAGAGCAATG -3'

Sequencing Primer
(F):5'- GGACTCATTCAATTTCCACTGCAAC -3'
(R):5'- GAGCAATGTGTATGATCTACCACTGC -3'
Posted On2020-07-13