Incidental Mutation 'R8191:Tnn'
ID635127
Institutional Source Beutler Lab
Gene Symbol Tnn
Ensembl Gene ENSMUSG00000026725
Gene Nametenascin N
SynonymsTnw, tenascin-W
MMRRC Submission
Accession Numbers

Genbank: NM_177839.3; Ensembl: ENSMUST00000039178

Is this an essential gene? Possibly non essential (E-score: 0.400) question?
Stock #R8191 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location160085029-160153580 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 160125518 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 651 (V651M)
Ref Sequence ENSEMBL: ENSMUSP00000039452 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039178] [ENSMUST00000131919]
Predicted Effect probably damaging
Transcript: ENSMUST00000039178
AA Change: V651M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000039452
Gene: ENSMUSG00000026725
AA Change: V651M

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
coiled coil region 100 132 N/A INTRINSIC
EGF_like 170 198 3.5e1 SMART
EGF 201 229 2.29e1 SMART
EGF_like 232 260 2.86e1 SMART
FN3 262 341 1.81e-8 SMART
FN3 351 432 1.08e-6 SMART
FN3 443 521 1.19e-8 SMART
FN3 531 608 2.64e-10 SMART
FN3 619 696 1.6e-9 SMART
FN3 707 784 9.04e-9 SMART
FN3 795 872 7.34e-9 SMART
FN3 883 960 9.04e-9 SMART
FN3 971 1048 1.07e-10 SMART
FN3 1059 1136 7.57e-11 SMART
FN3 1147 1224 4.59e-10 SMART
FN3 1235 1312 1.95e-4 SMART
FBG 1327 1539 1.16e-114 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000131919
AA Change: V651M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115685
Gene: ENSMUSG00000026725
AA Change: V651M

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
coiled coil region 100 132 N/A INTRINSIC
EGF_like 170 198 3.5e1 SMART
EGF 201 229 2.29e1 SMART
EGF_like 232 260 2.86e1 SMART
FN3 262 341 1.81e-8 SMART
FN3 351 432 1.08e-6 SMART
FN3 443 521 1.19e-8 SMART
FN3 531 608 2.64e-10 SMART
FN3 619 696 1.6e-9 SMART
FN3 707 784 9.04e-9 SMART
FN3 795 872 7.57e-11 SMART
FN3 883 960 4.59e-10 SMART
FN3 971 1048 1.95e-4 SMART
FBG 1063 1275 1.16e-114 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110004E09Rik G T 16: 90,931,001 N100K probably damaging Het
1700037C18Rik G A 16: 3,907,054 R49W probably damaging Het
Adamts4 T C 1: 171,252,723 S282P Het
AI314180 A T 4: 58,872,587 probably null Het
Aqp4 A G 18: 15,398,165 S180P probably benign Het
Armc2 T G 10: 41,963,751 E406A probably benign Het
Atp13a3 A T 16: 30,349,780 Y464N probably damaging Het
B3gnt3 C A 8: 71,693,478 V136L probably benign Het
Cacna1s C T 1: 136,108,155 H1378Y probably damaging Het
Ccnk A T 12: 108,193,674 E138D probably benign Het
Cenpe A G 3: 135,251,614 K1878E probably benign Het
Cep57l1 T A 10: 41,740,959 I111L probably damaging Het
Copg2 T C 6: 30,813,730 I509V probably benign Het
Cux2 T A 5: 121,874,154 D406V probably benign Het
Cyp2a12 G T 7: 27,031,104 A165S probably benign Het
Dnaaf5 T G 5: 139,181,495 S719A probably benign Het
Dnah7c A G 1: 46,607,458 I1220V possibly damaging Het
Dnajb8 C T 6: 88,222,958 R159C possibly damaging Het
Dusp10 T A 1: 184,037,552 D238E possibly damaging Het
Dync1li1 C A 9: 114,709,185 D203E probably benign Het
Eif5b T C 1: 38,036,202 S587P probably damaging Het
Ephb2 G A 4: 136,658,945 T832I probably damaging Het
Exoc1 T A 5: 76,559,827 probably null Het
Fam193a T A 5: 34,440,573 N571K probably damaging Het
Fem1a T A 17: 56,258,356 I483N probably damaging Het
Fgf20 C A 8: 40,308,320 probably benign Het
Fkbp1a C T 2: 151,557,436 P98S Het
Gm9833 G T 3: 10,088,854 V228F probably damaging Het
Gpsm3 A T 17: 34,590,477 D19V probably benign Het
Ido2 C A 8: 24,533,680 G381W probably damaging Het
Ifi204 T C 1: 173,751,660 T540A possibly damaging Het
Isl1 A T 13: 116,305,418 M93K probably benign Het
Map3k10 T A 7: 27,663,246 S472C probably damaging Het
Mcrs1 A T 15: 99,243,325 V432E probably damaging Het
Metap2 A G 10: 93,865,405 probably null Het
Muc5b A G 7: 141,867,684 S4304G probably benign Het
Nell1 T C 7: 50,448,874 V308A unknown Het
Olfr1511 A G 14: 52,390,530 V81A probably benign Het
Olfr984 A T 9: 40,101,471 H6Q probably benign Het
Plxna4 C A 6: 32,516,950 V244F possibly damaging Het
Pnpla6 T C 8: 3,542,382 S1224P probably benign Het
Ripk4 A G 16: 97,763,526 probably benign Het
Rnpep T C 1: 135,272,434 E261G possibly damaging Het
Robo1 C A 16: 72,933,254 S194R probably damaging Het
Rpusd1 C G 17: 25,728,637 Y99* probably null Het
Scarf1 T C 11: 75,522,239 M437T probably benign Het
Sh3tc2 G T 18: 61,973,358 D153Y probably damaging Het
Siglec1 T C 2: 131,085,679 Y69C probably damaging Het
Slc25a34 T C 4: 141,620,584 Y262C probably damaging Het
Srrm2 T A 17: 23,820,245 N1954K probably damaging Het
St6galnac2 T C 11: 116,681,922 Y236C probably damaging Het
Stac3 T A 10: 127,508,199 I322N probably damaging Het
Tcaf1 T C 6: 42,675,256 Q764R probably damaging Het
Tcf20 G A 15: 82,853,405 R1282* probably null Het
Tlr2 T A 3: 83,836,514 K754M probably damaging Het
Tlr2 T G 3: 83,836,515 K754Q probably damaging Het
Ttn T C 2: 76,870,739 H9622R unknown Het
Tubgcp6 C T 15: 89,120,640 G259S probably damaging Het
Ubr5 C A 15: 38,006,507 C1174F Het
Ugt2b35 T A 5: 87,001,443 S184R probably damaging Het
Vit C T 17: 78,546,399 H25Y probably benign Het
Vmn1r177 G A 7: 23,866,311 Q47* probably null Het
Vmn2r104 A T 17: 20,030,203 V602D possibly damaging Het
Vmn2r115 A G 17: 23,359,556 T668A probably damaging Het
Vmn2r125 T G 4: 156,351,414 C362W probably damaging Het
Vwa7 A G 17: 35,019,736 T267A probably damaging Het
Wdr63 G T 3: 146,094,311 P158H probably damaging Het
Xpa C A 4: 46,183,225 R188L possibly damaging Het
Zfp143 C T 7: 110,077,157 T249I probably damaging Het
Zfp607a A G 7: 27,879,443 E646G possibly damaging Het
Zfp729a A T 13: 67,621,719 S130R probably benign Het
Zswim3 C A 2: 164,820,208 Q203K probably damaging Het
Other mutations in Tnn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Tnn APN 1 160125451 missense possibly damaging 0.65
IGL00433:Tnn APN 1 160098206 splice site probably benign
IGL00858:Tnn APN 1 160088392 critical splice donor site probably null
IGL00939:Tnn APN 1 160147530 missense probably damaging 1.00
IGL01569:Tnn APN 1 160120554 missense possibly damaging 0.51
IGL01591:Tnn APN 1 160125574 missense probably damaging 1.00
IGL01628:Tnn APN 1 160147602 missense possibly damaging 0.89
IGL01811:Tnn APN 1 160107135 missense probably damaging 1.00
IGL01813:Tnn APN 1 160088438 missense probably damaging 1.00
IGL02340:Tnn APN 1 160145205 missense probably benign 0.00
IGL02488:Tnn APN 1 160140593 missense probably benign 0.21
IGL02535:Tnn APN 1 160122652 splice site probably null
IGL02563:Tnn APN 1 160114553 missense probably damaging 1.00
IGL02572:Tnn APN 1 160086107 missense probably damaging 1.00
IGL02740:Tnn APN 1 160140777 splice site probably benign
IGL02818:Tnn APN 1 160116278 missense possibly damaging 0.86
IGL03284:Tnn APN 1 160125452 missense probably benign 0.01
1mM(1):Tnn UTSW 1 160097341 missense probably damaging 1.00
PIT4305001:Tnn UTSW 1 160086077 missense possibly damaging 0.91
R0023:Tnn UTSW 1 160104928 missense probably benign 0.00
R0234:Tnn UTSW 1 160088466 missense probably damaging 1.00
R0234:Tnn UTSW 1 160088466 missense probably damaging 1.00
R0316:Tnn UTSW 1 160120567 missense possibly damaging 0.93
R0492:Tnn UTSW 1 160120757 missense probably damaging 0.99
R0547:Tnn UTSW 1 160116337 intron probably benign
R1067:Tnn UTSW 1 160125398 missense probably damaging 1.00
R1563:Tnn UTSW 1 160125415 missense probably damaging 1.00
R1565:Tnn UTSW 1 160097265 missense probably damaging 1.00
R1615:Tnn UTSW 1 160118408 missense possibly damaging 0.93
R1637:Tnn UTSW 1 160147600 missense probably damaging 1.00
R1707:Tnn UTSW 1 160145144 missense probably damaging 1.00
R1758:Tnn UTSW 1 160147584 missense possibly damaging 0.61
R1797:Tnn UTSW 1 160140688 missense probably damaging 1.00
R1847:Tnn UTSW 1 160116182 missense possibly damaging 0.51
R1925:Tnn UTSW 1 160097229 missense probably damaging 1.00
R2182:Tnn UTSW 1 160140600 splice site probably null
R2196:Tnn UTSW 1 160097228 nonsense probably null
R2225:Tnn UTSW 1 160147465 missense probably damaging 1.00
R2227:Tnn UTSW 1 160147465 missense probably damaging 1.00
R2286:Tnn UTSW 1 160110509 missense possibly damaging 0.89
R2850:Tnn UTSW 1 160139287 missense probably benign 0.00
R3110:Tnn UTSW 1 160116286 missense possibly damaging 0.71
R3111:Tnn UTSW 1 160107055 missense probably damaging 0.98
R3112:Tnn UTSW 1 160116286 missense possibly damaging 0.71
R3729:Tnn UTSW 1 160146240 missense probably damaging 1.00
R4183:Tnn UTSW 1 160097355 missense probably damaging 1.00
R4439:Tnn UTSW 1 160116080 missense probably benign
R4441:Tnn UTSW 1 160116080 missense probably benign
R4588:Tnn UTSW 1 160145111 missense probably benign 0.25
R4646:Tnn UTSW 1 160146042 missense probably benign
R4647:Tnn UTSW 1 160146042 missense probably benign
R4648:Tnn UTSW 1 160146042 missense probably benign
R4701:Tnn UTSW 1 160147768 missense possibly damaging 0.72
R4703:Tnn UTSW 1 160116245 missense possibly damaging 0.84
R4737:Tnn UTSW 1 160146089 missense probably damaging 1.00
R4801:Tnn UTSW 1 160145033 missense possibly damaging 0.90
R4802:Tnn UTSW 1 160145033 missense possibly damaging 0.90
R4868:Tnn UTSW 1 160130873 missense possibly damaging 0.64
R4977:Tnn UTSW 1 160120618 missense probably damaging 1.00
R5011:Tnn UTSW 1 160126379 missense possibly damaging 0.89
R5026:Tnn UTSW 1 160146137 missense probably benign 0.00
R5027:Tnn UTSW 1 160145211 missense probably damaging 1.00
R5049:Tnn UTSW 1 160140738 missense probably benign 0.00
R5119:Tnn UTSW 1 160120552 missense probably damaging 0.98
R5128:Tnn UTSW 1 160122894 missense probably damaging 0.98
R5234:Tnn UTSW 1 160144999 missense possibly damaging 0.95
R5398:Tnn UTSW 1 160147522 missense probably benign 0.00
R5424:Tnn UTSW 1 160122702 missense possibly damaging 0.69
R5452:Tnn UTSW 1 160110261 missense probably benign 0.13
R5466:Tnn UTSW 1 160120536 missense possibly damaging 0.93
R6022:Tnn UTSW 1 160110358 missense probably benign 0.00
R6062:Tnn UTSW 1 160098278 missense probably damaging 1.00
R6086:Tnn UTSW 1 160086120 missense probably damaging 1.00
R6132:Tnn UTSW 1 160146071 missense probably damaging 0.96
R6324:Tnn UTSW 1 160145204 missense probably damaging 0.96
R6455:Tnn UTSW 1 160114719 missense probably damaging 1.00
R6563:Tnn UTSW 1 160088398 missense probably damaging 1.00
R6650:Tnn UTSW 1 160114583 missense probably damaging 1.00
R6806:Tnn UTSW 1 160120708 missense possibly damaging 0.95
R6810:Tnn UTSW 1 160104842 missense probably damaging 1.00
R7157:Tnn UTSW 1 160126377 nonsense probably null
R7243:Tnn UTSW 1 160107117 missense probably benign 0.07
R7340:Tnn UTSW 1 160146022 missense probably damaging 0.98
R7472:Tnn UTSW 1 160110347 missense probably benign 0.12
R7502:Tnn UTSW 1 160110359 missense probably benign 0.00
R7527:Tnn UTSW 1 160118504 missense possibly damaging 0.51
R7608:Tnn UTSW 1 160088414 nonsense probably null
R7746:Tnn UTSW 1 160114685 missense probably damaging 0.97
R8096:Tnn UTSW 1 160122841 missense probably damaging 1.00
R8136:Tnn UTSW 1 160107060 missense probably damaging 0.96
R8334:Tnn UTSW 1 160118483 missense probably damaging 1.00
R8335:Tnn UTSW 1 160118483 missense probably damaging 1.00
R8337:Tnn UTSW 1 160118483 missense probably damaging 1.00
R8338:Tnn UTSW 1 160118483 missense probably damaging 1.00
X0019:Tnn UTSW 1 160086146 missense probably damaging 1.00
Z1176:Tnn UTSW 1 160146293 missense probably benign
Z1177:Tnn UTSW 1 160126527 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCAATGCGTGTCCCATTAC -3'
(R):5'- AGGCTTGGCTTGGTAAACC -3'

Sequencing Primer
(F):5'- AATGCGTGTCCCATTACCTGTG -3'
(R):5'- AACCATTGCCTTGTGCTGAATG -3'
Posted On2020-07-13