Incidental Mutation 'R8191:Cenpe'
ID635138
Institutional Source Beutler Lab
Gene Symbol Cenpe
Ensembl Gene ENSMUSG00000045328
Gene Namecentromere protein E
Synonyms312kDa, CENP-E, Kif10, N-7 kinesin
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8191 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location135212537-135273611 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 135251614 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 1878 (K1878E)
Ref Sequence ENSEMBL: ENSMUSP00000057938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062893] [ENSMUST00000197369]
Predicted Effect probably benign
Transcript: ENSMUST00000062893
AA Change: K1878E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000057938
Gene: ENSMUSG00000045328
AA Change: K1878E

DomainStartEndE-ValueType
KISc 4 337 2.4e-172 SMART
coiled coil region 493 612 N/A INTRINSIC
coiled coil region 637 752 N/A INTRINSIC
internal_repeat_1 768 801 3.5e-5 PROSPERO
coiled coil region 821 991 N/A INTRINSIC
low complexity region 1119 1143 N/A INTRINSIC
internal_repeat_2 1225 1238 6.26e-5 PROSPERO
low complexity region 1446 1467 N/A INTRINSIC
low complexity region 1480 1498 N/A INTRINSIC
internal_repeat_2 1614 1627 6.26e-5 PROSPERO
internal_repeat_1 2018 2051 3.5e-5 PROSPERO
coiled coil region 2226 2247 N/A INTRINSIC
coiled coil region 2316 2363 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197369
SMART Domains Protein: ENSMUSP00000143435
Gene: ENSMUSG00000045328

DomainStartEndE-ValueType
coiled coil region 2 49 N/A INTRINSIC
coiled coil region 85 172 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Centrosome-associated protein E (CENPE) is a kinesin-like motor protein that accumulates in the G2 phase of the cell cycle. Unlike other centrosome-associated proteins, it is not present during interphase and first appears at the centromere region of chromosomes during prometaphase. This protein is required for stable spindle microtubule capture at kinetochores which is a necessary step in chromosome alignment during prometaphase. This protein also couples chromosome position to microtubule depolymerizing activity. Alternative splicing results in multiple transcript variants encoding distinct protein isoforms. [provided by RefSeq, Nov 2014]
PHENOTYPE: Mice homozygous for a knock-out allele display early embryonic lethality. Mutant embryos grown in culture exhibit inner cell mass growth defects and mitotic chromosome misalignment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110004E09Rik G T 16: 90,931,001 N100K probably damaging Het
1700037C18Rik G A 16: 3,907,054 R49W probably damaging Het
Adamts4 T C 1: 171,252,723 S282P Het
AI314180 A T 4: 58,872,587 probably null Het
Aqp4 A G 18: 15,398,165 S180P probably benign Het
Armc2 T G 10: 41,963,751 E406A probably benign Het
Atp13a3 A T 16: 30,349,780 Y464N probably damaging Het
B3gnt3 C A 8: 71,693,478 V136L probably benign Het
Cacna1s C T 1: 136,108,155 H1378Y probably damaging Het
Ccnk A T 12: 108,193,674 E138D probably benign Het
Cep57l1 T A 10: 41,740,959 I111L probably damaging Het
Copg2 T C 6: 30,813,730 I509V probably benign Het
Cux2 T A 5: 121,874,154 D406V probably benign Het
Cyp2a12 G T 7: 27,031,104 A165S probably benign Het
Dnaaf5 T G 5: 139,181,495 S719A probably benign Het
Dnah7c A G 1: 46,607,458 I1220V possibly damaging Het
Dnajb8 C T 6: 88,222,958 R159C possibly damaging Het
Dusp10 T A 1: 184,037,552 D238E possibly damaging Het
Dync1li1 C A 9: 114,709,185 D203E probably benign Het
Eif5b T C 1: 38,036,202 S587P probably damaging Het
Ephb2 G A 4: 136,658,945 T832I probably damaging Het
Exoc1 T A 5: 76,559,827 probably null Het
Fam193a T A 5: 34,440,573 N571K probably damaging Het
Fem1a T A 17: 56,258,356 I483N probably damaging Het
Fgf20 C A 8: 40,308,320 probably benign Het
Fkbp1a C T 2: 151,557,436 P98S Het
Gm9833 G T 3: 10,088,854 V228F probably damaging Het
Gpsm3 A T 17: 34,590,477 D19V probably benign Het
Ido2 C A 8: 24,533,680 G381W probably damaging Het
Ifi204 T C 1: 173,751,660 T540A possibly damaging Het
Isl1 A T 13: 116,305,418 M93K probably benign Het
Map3k10 T A 7: 27,663,246 S472C probably damaging Het
Mcrs1 A T 15: 99,243,325 V432E probably damaging Het
Metap2 A G 10: 93,865,405 probably null Het
Muc5b A G 7: 141,867,684 S4304G probably benign Het
Nell1 T C 7: 50,448,874 V308A unknown Het
Olfr1511 A G 14: 52,390,530 V81A probably benign Het
Olfr984 A T 9: 40,101,471 H6Q probably benign Het
Plxna4 C A 6: 32,516,950 V244F possibly damaging Het
Pnpla6 T C 8: 3,542,382 S1224P probably benign Het
Ripk4 A G 16: 97,763,526 probably benign Het
Rnpep T C 1: 135,272,434 E261G possibly damaging Het
Robo1 C A 16: 72,933,254 S194R probably damaging Het
Rpusd1 C G 17: 25,728,637 Y99* probably null Het
Scarf1 T C 11: 75,522,239 M437T probably benign Het
Sh3tc2 G T 18: 61,973,358 D153Y probably damaging Het
Siglec1 T C 2: 131,085,679 Y69C probably damaging Het
Slc25a34 T C 4: 141,620,584 Y262C probably damaging Het
Srrm2 T A 17: 23,820,245 N1954K probably damaging Het
St6galnac2 T C 11: 116,681,922 Y236C probably damaging Het
Stac3 T A 10: 127,508,199 I322N probably damaging Het
Tcaf1 T C 6: 42,675,256 Q764R probably damaging Het
Tcf20 G A 15: 82,853,405 R1282* probably null Het
Tlr2 T A 3: 83,836,514 K754M probably damaging Het
Tlr2 T G 3: 83,836,515 K754Q probably damaging Het
Tnn C T 1: 160,125,518 V651M probably damaging Het
Ttn T C 2: 76,870,739 H9622R unknown Het
Tubgcp6 C T 15: 89,120,640 G259S probably damaging Het
Ubr5 C A 15: 38,006,507 C1174F Het
Ugt2b35 T A 5: 87,001,443 S184R probably damaging Het
Vit C T 17: 78,546,399 H25Y probably benign Het
Vmn1r177 G A 7: 23,866,311 Q47* probably null Het
Vmn2r104 A T 17: 20,030,203 V602D possibly damaging Het
Vmn2r115 A G 17: 23,359,556 T668A probably damaging Het
Vmn2r125 T G 4: 156,351,414 C362W probably damaging Het
Vwa7 A G 17: 35,019,736 T267A probably damaging Het
Wdr63 G T 3: 146,094,311 P158H probably damaging Het
Xpa C A 4: 46,183,225 R188L possibly damaging Het
Zfp143 C T 7: 110,077,157 T249I probably damaging Het
Zfp607a A G 7: 27,879,443 E646G possibly damaging Het
Zfp729a A T 13: 67,621,719 S130R probably benign Het
Zswim3 C A 2: 164,820,208 Q203K probably damaging Het
Other mutations in Cenpe
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00655:Cenpe APN 3 135231455 critical splice donor site probably null
IGL00799:Cenpe APN 3 135228917 critical splice donor site probably null
IGL00815:Cenpe APN 3 135259351 missense probably benign
IGL01446:Cenpe APN 3 135237539 missense probably benign 0.01
IGL01469:Cenpe APN 3 135228806 missense probably damaging 1.00
IGL01843:Cenpe APN 3 135218507 missense possibly damaging 0.88
IGL02254:Cenpe APN 3 135255477 missense probably benign
IGL02337:Cenpe APN 3 135220276 splice site probably benign
IGL02382:Cenpe APN 3 135247386 missense probably benign
IGL02458:Cenpe APN 3 135230108 nonsense probably null
IGL02934:Cenpe APN 3 135264351 missense probably damaging 1.00
IGL03335:Cenpe APN 3 135243625 missense probably benign
R0086:Cenpe UTSW 3 135264424 splice site probably benign
R0173:Cenpe UTSW 3 135259983 missense probably benign 0.00
R0394:Cenpe UTSW 3 135216425 splice site probably benign
R0411:Cenpe UTSW 3 135222255 missense probably damaging 1.00
R0624:Cenpe UTSW 3 135246586 missense probably benign 0.00
R0634:Cenpe UTSW 3 135246827 missense probably damaging 1.00
R0648:Cenpe UTSW 3 135230082 missense probably damaging 1.00
R0691:Cenpe UTSW 3 135217305 missense probably damaging 1.00
R1184:Cenpe UTSW 3 135264422 critical splice donor site probably null
R1530:Cenpe UTSW 3 135246902 missense possibly damaging 0.92
R1559:Cenpe UTSW 3 135270900 missense probably benign 0.07
R1562:Cenpe UTSW 3 135238394 missense possibly damaging 0.53
R1568:Cenpe UTSW 3 135239758 missense probably benign 0.01
R1712:Cenpe UTSW 3 135265933 missense probably damaging 0.99
R1828:Cenpe UTSW 3 135246496 missense probably damaging 0.99
R1846:Cenpe UTSW 3 135239845 missense probably damaging 1.00
R1861:Cenpe UTSW 3 135268979 missense probably damaging 1.00
R1938:Cenpe UTSW 3 135247479 missense probably damaging 0.98
R1961:Cenpe UTSW 3 135242493 missense probably damaging 1.00
R2062:Cenpe UTSW 3 135222321 splice site probably benign
R2118:Cenpe UTSW 3 135246884 missense possibly damaging 0.94
R2127:Cenpe UTSW 3 135239780 missense probably benign 0.08
R2156:Cenpe UTSW 3 135247474 missense probably benign 0.34
R2265:Cenpe UTSW 3 135261636 missense probably benign 0.02
R2268:Cenpe UTSW 3 135261636 missense probably benign 0.02
R2392:Cenpe UTSW 3 135248113 missense probably damaging 1.00
R2508:Cenpe UTSW 3 135241073 missense possibly damaging 0.92
R3084:Cenpe UTSW 3 135241021 missense probably damaging 1.00
R3779:Cenpe UTSW 3 135256576 missense possibly damaging 0.87
R3833:Cenpe UTSW 3 135222322 splice site probably benign
R3974:Cenpe UTSW 3 135235225 splice site probably null
R3975:Cenpe UTSW 3 135235225 splice site probably null
R3975:Cenpe UTSW 3 135238472 critical splice donor site probably null
R4151:Cenpe UTSW 3 135215153 missense probably benign 0.36
R4166:Cenpe UTSW 3 135243718 missense probably damaging 1.00
R4581:Cenpe UTSW 3 135247000 missense probably benign 0.30
R4622:Cenpe UTSW 3 135243708 missense probably benign 0.22
R4692:Cenpe UTSW 3 135216379 missense probably benign 0.29
R4769:Cenpe UTSW 3 135248151 missense probably benign
R4976:Cenpe UTSW 3 135234876 missense probably damaging 1.00
R4983:Cenpe UTSW 3 135234928 missense probably damaging 1.00
R4990:Cenpe UTSW 3 135256640 missense probably damaging 1.00
R5002:Cenpe UTSW 3 135247081 missense probably benign
R5057:Cenpe UTSW 3 135220313 missense probably benign 0.14
R5063:Cenpe UTSW 3 135270954 missense probably damaging 0.99
R5181:Cenpe UTSW 3 135242303 missense probably damaging 0.99
R5281:Cenpe UTSW 3 135230150 missense possibly damaging 0.89
R5389:Cenpe UTSW 3 135259388 critical splice donor site probably null
R5517:Cenpe UTSW 3 135223265 missense probably damaging 1.00
R5521:Cenpe UTSW 3 135269065 missense probably damaging 1.00
R5607:Cenpe UTSW 3 135235076 nonsense probably null
R5608:Cenpe UTSW 3 135235076 nonsense probably null
R5627:Cenpe UTSW 3 135235473 missense possibly damaging 0.51
R5766:Cenpe UTSW 3 135248413 missense probably damaging 0.96
R5783:Cenpe UTSW 3 135261580 missense probably benign 0.00
R5933:Cenpe UTSW 3 135261628 missense probably benign 0.03
R6073:Cenpe UTSW 3 135260073 nonsense probably null
R6163:Cenpe UTSW 3 135269003 missense probably damaging 0.99
R6192:Cenpe UTSW 3 135248530 missense possibly damaging 0.93
R6224:Cenpe UTSW 3 135243775 missense possibly damaging 0.87
R6313:Cenpe UTSW 3 135230175 missense probably benign 0.26
R6326:Cenpe UTSW 3 135239778 missense probably benign 0.15
R6383:Cenpe UTSW 3 135251528 missense probably damaging 1.00
R6418:Cenpe UTSW 3 135251544 missense probably damaging 0.99
R6797:Cenpe UTSW 3 135238138 missense possibly damaging 0.92
R6810:Cenpe UTSW 3 135243822 missense probably benign 0.00
R6989:Cenpe UTSW 3 135235127 missense probably damaging 1.00
R7009:Cenpe UTSW 3 135235201 missense probably damaging 0.97
R7009:Cenpe UTSW 3 135235202 missense probably benign 0.02
R7039:Cenpe UTSW 3 135255456 missense probably benign 0.28
R7387:Cenpe UTSW 3 135247037 missense probably benign 0.05
R7470:Cenpe UTSW 3 135242155 missense probably damaging 1.00
R7535:Cenpe UTSW 3 135243762 missense possibly damaging 0.90
R7562:Cenpe UTSW 3 135248634 missense probably damaging 1.00
R7573:Cenpe UTSW 3 135247459 missense probably damaging 1.00
R7613:Cenpe UTSW 3 135242302 missense possibly damaging 0.90
R7741:Cenpe UTSW 3 135247335 splice site probably null
R7771:Cenpe UTSW 3 135240941 splice site probably null
R7843:Cenpe UTSW 3 135232959 nonsense probably null
R7926:Cenpe UTSW 3 135232959 nonsense probably null
R8036:Cenpe UTSW 3 135239848 frame shift probably null
R8069:Cenpe UTSW 3 135243718 missense probably damaging 1.00
R8151:Cenpe UTSW 3 135247022 missense probably benign 0.28
R8176:Cenpe UTSW 3 135230090 missense probably damaging 1.00
R8251:Cenpe UTSW 3 135251684 critical splice donor site probably null
Z1177:Cenpe UTSW 3 135216385 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- GTGAGCGTCAACGTGTTAAG -3'
(R):5'- ACACTGCTGAGCTGCAAAGAC -3'

Sequencing Primer
(F):5'- GCGTCAACGTGTTAAGTTAAAAGC -3'
(R):5'- GATTCTAGCCATTGCAGGTACCAG -3'
Posted On2020-07-13