Incidental Mutation 'R8191:Xpa'
ID635140
Institutional Source Beutler Lab
Gene Symbol Xpa
Ensembl Gene ENSMUSG00000028329
Gene Namexeroderma pigmentosum, complementation group A
SynonymsXpac
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8191 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location46155347-46196311 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 46183225 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 188 (R188L)
Ref Sequence ENSEMBL: ENSMUSP00000050453 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030013] [ENSMUST00000058232] [ENSMUST00000132358] [ENSMUST00000142380]
Predicted Effect probably damaging
Transcript: ENSMUST00000030013
AA Change: R188L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000030013
Gene: ENSMUSG00000028329
AA Change: R188L

DomainStartEndE-ValueType
low complexity region 32 55 N/A INTRINSIC
Pfam:XPA_N 99 132 1.5e-20 PFAM
Pfam:XPA_C 133 185 3.7e-28 PFAM
low complexity region 212 223 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000058232
AA Change: R188L

PolyPhen 2 Score 0.561 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000050453
Gene: ENSMUSG00000028329
AA Change: R188L

DomainStartEndE-ValueType
low complexity region 32 55 N/A INTRINSIC
Pfam:XPA_N 101 132 5.2e-18 PFAM
Pfam:XPA_C 134 185 3e-30 PFAM
low complexity region 212 223 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000132358
AA Change: R79L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138512
Gene: ENSMUSG00000028329
AA Change: R79L

DomainStartEndE-ValueType
Pfam:XPA_N 1 23 1.1e-13 PFAM
Pfam:XPA_C 24 76 7.9e-29 PFAM
low complexity region 103 114 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000142380
AA Change: R188L

PolyPhen 2 Score 0.688 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000121850
Gene: ENSMUSG00000028329
AA Change: R188L

DomainStartEndE-ValueType
low complexity region 32 55 N/A INTRINSIC
Pfam:XPA_N 99 132 1.5e-20 PFAM
Pfam:XPA_C 133 185 3.7e-28 PFAM
low complexity region 212 225 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc finger protein involved in DNA excision repair. The encoded protein is part of the NER (nucleotide excision repair) complext which is responsible for repair of UV radiation-induced photoproducts and DNA adducts induced by chemical carcinogens. Mutations in this gene are associated with xeroderma pigmentosum complementation group A. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygous null mutants are highly susceptible to tumors induced by UV (skin and ocular tumors), 7,12-dimethylbenz[a]anthracene (skin tumors), benzo[a]pyrene (pulmonary tumors), 4-nitroquinoline-1-oxide (tongue tumors) and aflatoxin B(1) (liver tumors). [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110004E09Rik G T 16: 90,931,001 N100K probably damaging Het
1700037C18Rik G A 16: 3,907,054 R49W probably damaging Het
Adamts4 T C 1: 171,252,723 S282P Het
AI314180 A T 4: 58,872,587 probably null Het
Aqp4 A G 18: 15,398,165 S180P probably benign Het
Armc2 T G 10: 41,963,751 E406A probably benign Het
Atp13a3 A T 16: 30,349,780 Y464N probably damaging Het
B3gnt3 C A 8: 71,693,478 V136L probably benign Het
Cacna1s C T 1: 136,108,155 H1378Y probably damaging Het
Ccnk A T 12: 108,193,674 E138D probably benign Het
Cenpe A G 3: 135,251,614 K1878E probably benign Het
Cep57l1 T A 10: 41,740,959 I111L probably damaging Het
Copg2 T C 6: 30,813,730 I509V probably benign Het
Cux2 T A 5: 121,874,154 D406V probably benign Het
Cyp2a12 G T 7: 27,031,104 A165S probably benign Het
Dnaaf5 T G 5: 139,181,495 S719A probably benign Het
Dnah7c A G 1: 46,607,458 I1220V possibly damaging Het
Dnajb8 C T 6: 88,222,958 R159C possibly damaging Het
Dusp10 T A 1: 184,037,552 D238E possibly damaging Het
Dync1li1 C A 9: 114,709,185 D203E probably benign Het
Eif5b T C 1: 38,036,202 S587P probably damaging Het
Ephb2 G A 4: 136,658,945 T832I probably damaging Het
Exoc1 T A 5: 76,559,827 probably null Het
Fam193a T A 5: 34,440,573 N571K probably damaging Het
Fem1a T A 17: 56,258,356 I483N probably damaging Het
Fgf20 C A 8: 40,308,320 probably benign Het
Fkbp1a C T 2: 151,557,436 P98S Het
Gm9833 G T 3: 10,088,854 V228F probably damaging Het
Gpsm3 A T 17: 34,590,477 D19V probably benign Het
Ido2 C A 8: 24,533,680 G381W probably damaging Het
Ifi204 T C 1: 173,751,660 T540A possibly damaging Het
Isl1 A T 13: 116,305,418 M93K probably benign Het
Map3k10 T A 7: 27,663,246 S472C probably damaging Het
Mcrs1 A T 15: 99,243,325 V432E probably damaging Het
Metap2 A G 10: 93,865,405 probably null Het
Muc5b A G 7: 141,867,684 S4304G probably benign Het
Nell1 T C 7: 50,448,874 V308A unknown Het
Olfr1511 A G 14: 52,390,530 V81A probably benign Het
Olfr984 A T 9: 40,101,471 H6Q probably benign Het
Plxna4 C A 6: 32,516,950 V244F possibly damaging Het
Pnpla6 T C 8: 3,542,382 S1224P probably benign Het
Ripk4 A G 16: 97,763,526 probably benign Het
Rnpep T C 1: 135,272,434 E261G possibly damaging Het
Robo1 C A 16: 72,933,254 S194R probably damaging Het
Rpusd1 C G 17: 25,728,637 Y99* probably null Het
Scarf1 T C 11: 75,522,239 M437T probably benign Het
Sh3tc2 G T 18: 61,973,358 D153Y probably damaging Het
Siglec1 T C 2: 131,085,679 Y69C probably damaging Het
Slc25a34 T C 4: 141,620,584 Y262C probably damaging Het
Srrm2 T A 17: 23,820,245 N1954K probably damaging Het
St6galnac2 T C 11: 116,681,922 Y236C probably damaging Het
Stac3 T A 10: 127,508,199 I322N probably damaging Het
Tcaf1 T C 6: 42,675,256 Q764R probably damaging Het
Tcf20 G A 15: 82,853,405 R1282* probably null Het
Tlr2 T A 3: 83,836,514 K754M probably damaging Het
Tlr2 T G 3: 83,836,515 K754Q probably damaging Het
Tnn C T 1: 160,125,518 V651M probably damaging Het
Ttn T C 2: 76,870,739 H9622R unknown Het
Tubgcp6 C T 15: 89,120,640 G259S probably damaging Het
Ubr5 C A 15: 38,006,507 C1174F Het
Ugt2b35 T A 5: 87,001,443 S184R probably damaging Het
Vit C T 17: 78,546,399 H25Y probably benign Het
Vmn1r177 G A 7: 23,866,311 Q47* probably null Het
Vmn2r104 A T 17: 20,030,203 V602D possibly damaging Het
Vmn2r115 A G 17: 23,359,556 T668A probably damaging Het
Vmn2r125 T G 4: 156,351,414 C362W probably damaging Het
Vwa7 A G 17: 35,019,736 T267A probably damaging Het
Wdr63 G T 3: 146,094,311 P158H probably damaging Het
Zfp143 C T 7: 110,077,157 T249I probably damaging Het
Zfp607a A G 7: 27,879,443 E646G possibly damaging Het
Zfp729a A T 13: 67,621,719 S130R probably benign Het
Zswim3 C A 2: 164,820,208 Q203K probably damaging Het
Other mutations in Xpa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02127:Xpa APN 4 46185606 missense probably damaging 1.00
IGL02670:Xpa APN 4 46185682 missense probably benign 0.03
R1863:Xpa UTSW 4 46155730 intron probably benign
R2149:Xpa UTSW 4 46183189 missense probably damaging 0.99
R4534:Xpa UTSW 4 46185624 missense probably benign 0.00
R5308:Xpa UTSW 4 46185659 missense probably benign 0.00
R6647:Xpa UTSW 4 46183089 missense probably benign 0.00
R7157:Xpa UTSW 4 46185612 missense probably damaging 1.00
R7185:Xpa UTSW 4 46183078 missense probably benign
R8219:Xpa UTSW 4 46183150 missense probably benign 0.02
Z1177:Xpa UTSW 4 46183036 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- GGTTGACCCAAGCCTCATAC -3'
(R):5'- GAACTTGTATTTCAACTCCTTCTGG -3'

Sequencing Primer
(F):5'- CAAAGCACGCAGGCCAG -3'
(R):5'- CTCCTTCTGGAAAAAGTGGGACC -3'
Posted On2020-07-13