Incidental Mutation 'R8191:Ugt2b35'
ID635147
Institutional Source Beutler Lab
Gene Symbol Ugt2b35
Ensembl Gene ENSMUSG00000035811
Gene NameUDP glucuronosyltransferase 2 family, polypeptide B35
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R8191 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location87000860-87013275 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 87001443 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 184 (S184R)
Ref Sequence ENSEMBL: ENSMUSP00000031186 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031186]
Predicted Effect probably damaging
Transcript: ENSMUST00000031186
AA Change: S184R

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000031186
Gene: ENSMUSG00000035811
AA Change: S184R

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:UDPGT 24 526 1e-253 PFAM
Pfam:Glyco_tran_28_C 338 449 1.9e-8 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110004E09Rik G T 16: 90,931,001 N100K probably damaging Het
1700037C18Rik G A 16: 3,907,054 R49W probably damaging Het
Adamts4 T C 1: 171,252,723 S282P Het
AI314180 A T 4: 58,872,587 probably null Het
Aqp4 A G 18: 15,398,165 S180P probably benign Het
Armc2 T G 10: 41,963,751 E406A probably benign Het
Atp13a3 A T 16: 30,349,780 Y464N probably damaging Het
B3gnt3 C A 8: 71,693,478 V136L probably benign Het
Cacna1s C T 1: 136,108,155 H1378Y probably damaging Het
Ccnk A T 12: 108,193,674 E138D probably benign Het
Cenpe A G 3: 135,251,614 K1878E probably benign Het
Cep57l1 T A 10: 41,740,959 I111L probably damaging Het
Copg2 T C 6: 30,813,730 I509V probably benign Het
Cux2 T A 5: 121,874,154 D406V probably benign Het
Cyp2a12 G T 7: 27,031,104 A165S probably benign Het
Dnaaf5 T G 5: 139,181,495 S719A probably benign Het
Dnah7c A G 1: 46,607,458 I1220V possibly damaging Het
Dnajb8 C T 6: 88,222,958 R159C possibly damaging Het
Dusp10 T A 1: 184,037,552 D238E possibly damaging Het
Dync1li1 C A 9: 114,709,185 D203E probably benign Het
Eif5b T C 1: 38,036,202 S587P probably damaging Het
Ephb2 G A 4: 136,658,945 T832I probably damaging Het
Exoc1 T A 5: 76,559,827 probably null Het
Fam193a T A 5: 34,440,573 N571K probably damaging Het
Fem1a T A 17: 56,258,356 I483N probably damaging Het
Fgf20 C A 8: 40,308,320 probably benign Het
Fkbp1a C T 2: 151,557,436 P98S Het
Gm9833 G T 3: 10,088,854 V228F probably damaging Het
Gpsm3 A T 17: 34,590,477 D19V probably benign Het
Ido2 C A 8: 24,533,680 G381W probably damaging Het
Ifi204 T C 1: 173,751,660 T540A possibly damaging Het
Isl1 A T 13: 116,305,418 M93K probably benign Het
Map3k10 T A 7: 27,663,246 S472C probably damaging Het
Mcrs1 A T 15: 99,243,325 V432E probably damaging Het
Metap2 A G 10: 93,865,405 probably null Het
Muc5b A G 7: 141,867,684 S4304G probably benign Het
Nell1 T C 7: 50,448,874 V308A unknown Het
Olfr1511 A G 14: 52,390,530 V81A probably benign Het
Olfr984 A T 9: 40,101,471 H6Q probably benign Het
Plxna4 C A 6: 32,516,950 V244F possibly damaging Het
Pnpla6 T C 8: 3,542,382 S1224P probably benign Het
Ripk4 A G 16: 97,763,526 probably benign Het
Rnpep T C 1: 135,272,434 E261G possibly damaging Het
Robo1 C A 16: 72,933,254 S194R probably damaging Het
Rpusd1 C G 17: 25,728,637 Y99* probably null Het
Scarf1 T C 11: 75,522,239 M437T probably benign Het
Sh3tc2 G T 18: 61,973,358 D153Y probably damaging Het
Siglec1 T C 2: 131,085,679 Y69C probably damaging Het
Slc25a34 T C 4: 141,620,584 Y262C probably damaging Het
Srrm2 T A 17: 23,820,245 N1954K probably damaging Het
St6galnac2 T C 11: 116,681,922 Y236C probably damaging Het
Stac3 T A 10: 127,508,199 I322N probably damaging Het
Tcaf1 T C 6: 42,675,256 Q764R probably damaging Het
Tcf20 G A 15: 82,853,405 R1282* probably null Het
Tlr2 T A 3: 83,836,514 K754M probably damaging Het
Tlr2 T G 3: 83,836,515 K754Q probably damaging Het
Tnn C T 1: 160,125,518 V651M probably damaging Het
Ttn T C 2: 76,870,739 H9622R unknown Het
Tubgcp6 C T 15: 89,120,640 G259S probably damaging Het
Ubr5 C A 15: 38,006,507 C1174F Het
Vit C T 17: 78,546,399 H25Y probably benign Het
Vmn1r177 G A 7: 23,866,311 Q47* probably null Het
Vmn2r104 A T 17: 20,030,203 V602D possibly damaging Het
Vmn2r115 A G 17: 23,359,556 T668A probably damaging Het
Vmn2r125 T G 4: 156,351,414 C362W probably damaging Het
Vwa7 A G 17: 35,019,736 T267A probably damaging Het
Wdr63 G T 3: 146,094,311 P158H probably damaging Het
Xpa C A 4: 46,183,225 R188L possibly damaging Het
Zfp143 C T 7: 110,077,157 T249I probably damaging Het
Zfp607a A G 7: 27,879,443 E646G possibly damaging Het
Zfp729a A T 13: 67,621,719 S130R probably benign Het
Zswim3 C A 2: 164,820,208 Q203K probably damaging Het
Other mutations in Ugt2b35
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00703:Ugt2b35 APN 5 87008192 missense probably benign 0.00
IGL01109:Ugt2b35 APN 5 87008306 missense probably damaging 1.00
IGL01586:Ugt2b35 APN 5 87011391 missense probably benign 0.07
IGL02151:Ugt2b35 APN 5 87003282 missense possibly damaging 0.65
IGL02225:Ugt2b35 APN 5 87007405 splice site probably benign
IGL02483:Ugt2b35 APN 5 87001145 missense possibly damaging 0.87
IGL02504:Ugt2b35 APN 5 87001541 missense possibly damaging 0.50
IGL02690:Ugt2b35 APN 5 87001237 missense probably benign 0.01
IGL02954:Ugt2b35 APN 5 87011321 missense probably benign 0.00
IGL03242:Ugt2b35 APN 5 87007395 missense probably damaging 1.00
R0329:Ugt2b35 UTSW 5 87003405 missense probably null 0.38
R0513:Ugt2b35 UTSW 5 87003412 splice site probably benign
R0571:Ugt2b35 UTSW 5 87000934 missense possibly damaging 0.51
R0827:Ugt2b35 UTSW 5 87008130 splice site probably benign
R1396:Ugt2b35 UTSW 5 87011530 missense possibly damaging 0.56
R1437:Ugt2b35 UTSW 5 87001031 missense probably benign 0.02
R1557:Ugt2b35 UTSW 5 87007297 splice site probably null
R1869:Ugt2b35 UTSW 5 87001288 missense probably damaging 1.00
R1937:Ugt2b35 UTSW 5 87001282 missense probably damaging 1.00
R2067:Ugt2b35 UTSW 5 87001553 missense probably damaging 1.00
R2219:Ugt2b35 UTSW 5 87003332 missense possibly damaging 0.81
R3055:Ugt2b35 UTSW 5 87001598 missense probably benign 0.05
R3793:Ugt2b35 UTSW 5 87001606 missense probably benign 0.15
R4452:Ugt2b35 UTSW 5 87003378 missense probably damaging 0.99
R4548:Ugt2b35 UTSW 5 87008275 nonsense probably null
R4902:Ugt2b35 UTSW 5 87003300 missense possibly damaging 0.89
R5311:Ugt2b35 UTSW 5 87011280 nonsense probably null
R6187:Ugt2b35 UTSW 5 87007322 missense probably damaging 0.98
R6332:Ugt2b35 UTSW 5 87001556 missense probably damaging 1.00
R6719:Ugt2b35 UTSW 5 87007388 missense probably damaging 1.00
R7211:Ugt2b35 UTSW 5 87001318 missense probably benign 0.39
R7652:Ugt2b35 UTSW 5 87001510 missense probably damaging 0.99
R7766:Ugt2b35 UTSW 5 87001202 missense possibly damaging 0.94
R7825:Ugt2b35 UTSW 5 87001359 nonsense probably null
R8188:Ugt2b35 UTSW 5 87001443 missense probably damaging 0.98
R8189:Ugt2b35 UTSW 5 87001443 missense probably damaging 0.98
R8192:Ugt2b35 UTSW 5 87001443 missense probably damaging 0.98
R8193:Ugt2b35 UTSW 5 87001443 missense probably damaging 0.98
R8220:Ugt2b35 UTSW 5 87001443 missense probably damaging 0.98
R8288:Ugt2b35 UTSW 5 87001457 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCTAAGTCTTTGTAAGGAAGCTG -3'
(R):5'- TGTGTAGCTAGGGATATCAAGC -3'

Sequencing Primer
(F):5'- GTCTTTGTAAGGAAGCTGTTTCAAAC -3'
(R):5'- GTAGCTAGGGATATCAAGCTACTAAG -3'
Posted On2020-07-13