Incidental Mutation 'R8191:Plxna4'
ID635151
Institutional Source Beutler Lab
Gene Symbol Plxna4
Ensembl Gene ENSMUSG00000029765
Gene Nameplexin A4
SynonymsPlxa4
MMRRC Submission
Accession Numbers

Genbank: NM_175750

Is this an essential gene? Possibly essential (E-score: 0.571) question?
Stock #R8191 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location32144268-32588192 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 32516950 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 244 (V244F)
Ref Sequence ENSEMBL: ENSMUSP00000110748 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115096]
Predicted Effect possibly damaging
Transcript: ENSMUST00000115096
AA Change: V244F

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000110748
Gene: ENSMUSG00000029765
AA Change: V244F

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Sema 50 490 2.3e-131 SMART
PSI 508 558 2.21e-14 SMART
PSI 654 701 2.44e-7 SMART
PSI 802 855 1.2e-6 SMART
IPT 856 950 7.25e-16 SMART
IPT 952 1036 4.1e-15 SMART
IPT 1038 1138 2.86e-14 SMART
IPT 1140 1229 6.88e-1 SMART
transmembrane domain 1237 1259 N/A INTRINSIC
Pfam:Plexin_cytopl 1310 1863 1.8e-264 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150314
Meta Mutation Damage Score 0.2292 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice exhibit defective trajecotory and projection of peripheral sensory axons and sympathetic ganglion axons and the formation of the anterior commissure and the barrels. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, knock-out(2)

Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110004E09Rik G T 16: 90,931,001 N100K probably damaging Het
1700037C18Rik G A 16: 3,907,054 R49W probably damaging Het
Adamts4 T C 1: 171,252,723 S282P Het
AI314180 A T 4: 58,872,587 probably null Het
Aqp4 A G 18: 15,398,165 S180P probably benign Het
Armc2 T G 10: 41,963,751 E406A probably benign Het
Atp13a3 A T 16: 30,349,780 Y464N probably damaging Het
B3gnt3 C A 8: 71,693,478 V136L probably benign Het
Cacna1s C T 1: 136,108,155 H1378Y probably damaging Het
Ccnk A T 12: 108,193,674 E138D probably benign Het
Cenpe A G 3: 135,251,614 K1878E probably benign Het
Cep57l1 T A 10: 41,740,959 I111L probably damaging Het
Copg2 T C 6: 30,813,730 I509V probably benign Het
Cux2 T A 5: 121,874,154 D406V probably benign Het
Cyp2a12 G T 7: 27,031,104 A165S probably benign Het
Dnaaf5 T G 5: 139,181,495 S719A probably benign Het
Dnah7c A G 1: 46,607,458 I1220V possibly damaging Het
Dnajb8 C T 6: 88,222,958 R159C possibly damaging Het
Dusp10 T A 1: 184,037,552 D238E possibly damaging Het
Dync1li1 C A 9: 114,709,185 D203E probably benign Het
Eif5b T C 1: 38,036,202 S587P probably damaging Het
Ephb2 G A 4: 136,658,945 T832I probably damaging Het
Exoc1 T A 5: 76,559,827 probably null Het
Fam193a T A 5: 34,440,573 N571K probably damaging Het
Fem1a T A 17: 56,258,356 I483N probably damaging Het
Fgf20 C A 8: 40,308,320 probably benign Het
Fkbp1a C T 2: 151,557,436 P98S Het
Gm9833 G T 3: 10,088,854 V228F probably damaging Het
Gpsm3 A T 17: 34,590,477 D19V probably benign Het
Ido2 C A 8: 24,533,680 G381W probably damaging Het
Ifi204 T C 1: 173,751,660 T540A possibly damaging Het
Isl1 A T 13: 116,305,418 M93K probably benign Het
Map3k10 T A 7: 27,663,246 S472C probably damaging Het
Mcrs1 A T 15: 99,243,325 V432E probably damaging Het
Metap2 A G 10: 93,865,405 probably null Het
Muc5b A G 7: 141,867,684 S4304G probably benign Het
Nell1 T C 7: 50,448,874 V308A unknown Het
Olfr1511 A G 14: 52,390,530 V81A probably benign Het
Olfr984 A T 9: 40,101,471 H6Q probably benign Het
Pnpla6 T C 8: 3,542,382 S1224P probably benign Het
Ripk4 A G 16: 97,763,526 probably benign Het
Rnpep T C 1: 135,272,434 E261G possibly damaging Het
Robo1 C A 16: 72,933,254 S194R probably damaging Het
Rpusd1 C G 17: 25,728,637 Y99* probably null Het
Scarf1 T C 11: 75,522,239 M437T probably benign Het
Sh3tc2 G T 18: 61,973,358 D153Y probably damaging Het
Siglec1 T C 2: 131,085,679 Y69C probably damaging Het
Slc25a34 T C 4: 141,620,584 Y262C probably damaging Het
Srrm2 T A 17: 23,820,245 N1954K probably damaging Het
St6galnac2 T C 11: 116,681,922 Y236C probably damaging Het
Stac3 T A 10: 127,508,199 I322N probably damaging Het
Tcaf1 T C 6: 42,675,256 Q764R probably damaging Het
Tcf20 G A 15: 82,853,405 R1282* probably null Het
Tlr2 T A 3: 83,836,514 K754M probably damaging Het
Tlr2 T G 3: 83,836,515 K754Q probably damaging Het
Tnn C T 1: 160,125,518 V651M probably damaging Het
Ttn T C 2: 76,870,739 H9622R unknown Het
Tubgcp6 C T 15: 89,120,640 G259S probably damaging Het
Ubr5 C A 15: 38,006,507 C1174F Het
Ugt2b35 T A 5: 87,001,443 S184R probably damaging Het
Vit C T 17: 78,546,399 H25Y probably benign Het
Vmn1r177 G A 7: 23,866,311 Q47* probably null Het
Vmn2r104 A T 17: 20,030,203 V602D possibly damaging Het
Vmn2r115 A G 17: 23,359,556 T668A probably damaging Het
Vmn2r125 T G 4: 156,351,414 C362W probably damaging Het
Vwa7 A G 17: 35,019,736 T267A probably damaging Het
Wdr63 G T 3: 146,094,311 P158H probably damaging Het
Xpa C A 4: 46,183,225 R188L possibly damaging Het
Zfp143 C T 7: 110,077,157 T249I probably damaging Het
Zfp607a A G 7: 27,879,443 E646G possibly damaging Het
Zfp729a A T 13: 67,621,719 S130R probably benign Het
Zswim3 C A 2: 164,820,208 Q203K probably damaging Het
Other mutations in Plxna4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Plxna4 APN 6 32162091 missense probably damaging 1.00
IGL01395:Plxna4 APN 6 32239433 missense probably damaging 0.99
IGL01506:Plxna4 APN 6 32516535 missense probably damaging 1.00
IGL01606:Plxna4 APN 6 32158001 missense probably damaging 1.00
IGL01753:Plxna4 APN 6 32310478 missense probably benign 0.06
IGL01767:Plxna4 APN 6 32237678 missense possibly damaging 0.51
IGL01968:Plxna4 APN 6 32215204 missense possibly damaging 0.81
IGL02109:Plxna4 APN 6 32215641 missense probably benign
IGL02299:Plxna4 APN 6 32165156 missense probably benign 0.01
IGL02306:Plxna4 APN 6 32206124 missense probably benign 0.19
IGL02312:Plxna4 APN 6 32165117 missense possibly damaging 0.79
IGL02326:Plxna4 APN 6 32152905 missense probably damaging 0.99
IGL02658:Plxna4 APN 6 32185411 missense probably damaging 1.00
IGL02683:Plxna4 APN 6 32517606 missense probably benign 0.03
IGL02701:Plxna4 APN 6 32517559 missense probably benign 0.01
IGL02995:Plxna4 APN 6 32516595 missense probably damaging 1.00
IGL03030:Plxna4 APN 6 32202225 missense probably benign 0.01
IGL03264:Plxna4 APN 6 32178402 missense possibly damaging 0.64
IGL03304:Plxna4 APN 6 32165051 splice site probably benign
IGL03382:Plxna4 APN 6 32202194 missense probably benign 0.23
corona UTSW 6 32517264 missense probably damaging 1.00
inclined UTSW 6 32237723 nonsense probably null
Slope UTSW 6 32234606 missense probably benign 0.00
G4846:Plxna4 UTSW 6 32192272 missense probably damaging 1.00
R0133:Plxna4 UTSW 6 32197074 missense probably benign 0.00
R0200:Plxna4 UTSW 6 32197088 missense probably damaging 0.99
R0308:Plxna4 UTSW 6 32237768 missense probably benign 0.01
R0468:Plxna4 UTSW 6 32215246 missense probably damaging 1.00
R0505:Plxna4 UTSW 6 32202119 missense probably benign
R0542:Plxna4 UTSW 6 32192297 missense probably damaging 1.00
R0548:Plxna4 UTSW 6 32158015 missense probably damaging 1.00
R0652:Plxna4 UTSW 6 32185501 missense probably damaging 1.00
R1144:Plxna4 UTSW 6 32197156 missense possibly damaging 0.58
R1190:Plxna4 UTSW 6 32251136 missense probably damaging 1.00
R1228:Plxna4 UTSW 6 32224152 splice site probably null
R1569:Plxna4 UTSW 6 32185475 missense possibly damaging 0.78
R1803:Plxna4 UTSW 6 32517444 missense probably damaging 0.98
R1832:Plxna4 UTSW 6 32197826 missense probably benign 0.01
R2068:Plxna4 UTSW 6 32517616 missense possibly damaging 0.66
R2157:Plxna4 UTSW 6 32516974 missense probably benign 0.00
R2842:Plxna4 UTSW 6 32215631 critical splice donor site probably null
R2849:Plxna4 UTSW 6 32185532 missense probably damaging 1.00
R2892:Plxna4 UTSW 6 32517037 missense probably damaging 1.00
R2930:Plxna4 UTSW 6 32165780 missense probably damaging 1.00
R3892:Plxna4 UTSW 6 32215654 missense probably damaging 1.00
R4065:Plxna4 UTSW 6 32236365 nonsense probably null
R4276:Plxna4 UTSW 6 32200948 missense probably benign 0.29
R4307:Plxna4 UTSW 6 32163509 missense probably damaging 0.99
R4331:Plxna4 UTSW 6 32150545 nonsense probably null
R4478:Plxna4 UTSW 6 32196133 missense possibly damaging 0.89
R4529:Plxna4 UTSW 6 32496896 critical splice acceptor site probably null
R4566:Plxna4 UTSW 6 32517403 missense probably benign 0.00
R4568:Plxna4 UTSW 6 32152938 missense probably damaging 1.00
R4664:Plxna4 UTSW 6 32516950 missense possibly damaging 0.88
R4685:Plxna4 UTSW 6 32165844 missense probably damaging 1.00
R4701:Plxna4 UTSW 6 32516688 missense probably damaging 0.99
R4939:Plxna4 UTSW 6 32165762 missense probably damaging 1.00
R5153:Plxna4 UTSW 6 32224159 intron probably null
R5181:Plxna4 UTSW 6 32516997 missense probably damaging 1.00
R5256:Plxna4 UTSW 6 32251072 missense probably benign 0.03
R5259:Plxna4 UTSW 6 32517021 missense possibly damaging 0.89
R5306:Plxna4 UTSW 6 32206121 missense probably damaging 0.99
R5487:Plxna4 UTSW 6 32517283 missense probably damaging 1.00
R5510:Plxna4 UTSW 6 32178358 missense probably damaging 0.96
R5542:Plxna4 UTSW 6 32206230 missense probably damaging 1.00
R5567:Plxna4 UTSW 6 32157980 missense possibly damaging 0.61
R5634:Plxna4 UTSW 6 32237723 nonsense probably null
R5653:Plxna4 UTSW 6 32517616 missense possibly damaging 0.66
R5665:Plxna4 UTSW 6 32215722 missense probably damaging 1.00
R5845:Plxna4 UTSW 6 32237776 missense probably damaging 1.00
R5909:Plxna4 UTSW 6 32517246 missense probably damaging 1.00
R5938:Plxna4 UTSW 6 32234606 missense probably benign 0.00
R5973:Plxna4 UTSW 6 32251065 splice site probably null
R6433:Plxna4 UTSW 6 32215678 missense probably damaging 0.97
R6482:Plxna4 UTSW 6 32516737 missense probably benign
R6560:Plxna4 UTSW 6 32215678 missense probably damaging 0.97
R6721:Plxna4 UTSW 6 32200859 missense probably benign 0.26
R6810:Plxna4 UTSW 6 32310522 missense probably benign 0.18
R6985:Plxna4 UTSW 6 32237708 missense probably damaging 1.00
R7024:Plxna4 UTSW 6 32192269 missense probably damaging 1.00
R7046:Plxna4 UTSW 6 32516505 missense probably damaging 1.00
R7137:Plxna4 UTSW 6 32517264 missense probably damaging 1.00
R7163:Plxna4 UTSW 6 32496756 missense probably benign 0.01
R7199:Plxna4 UTSW 6 32215178 nonsense probably null
R7248:Plxna4 UTSW 6 32162160 missense probably damaging 0.99
R7260:Plxna4 UTSW 6 32239520 missense possibly damaging 0.79
R7361:Plxna4 UTSW 6 32196122 critical splice donor site probably null
R7383:Plxna4 UTSW 6 32152799 critical splice donor site probably null
R7405:Plxna4 UTSW 6 32196319 missense probably benign 0.00
R7516:Plxna4 UTSW 6 32237768 missense probably benign 0.00
R7635:Plxna4 UTSW 6 32496741 missense probably damaging 0.98
R7754:Plxna4 UTSW 6 32152872 missense probably damaging 1.00
R7763:Plxna4 UTSW 6 32223980 missense probably damaging 0.99
R7789:Plxna4 UTSW 6 32206233 critical splice acceptor site probably null
R8167:Plxna4 UTSW 6 32517046 missense probably damaging 0.99
R8225:Plxna4 UTSW 6 32162103 missense probably damaging 1.00
R8284:Plxna4 UTSW 6 32152854 missense probably benign 0.25
R8305:Plxna4 UTSW 6 32211065 missense possibly damaging 0.81
V1024:Plxna4 UTSW 6 32234574 missense probably damaging 1.00
X0027:Plxna4 UTSW 6 32517044 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACCAGCTTTAGACAAGTAGGC -3'
(R):5'- CACAGCAGTGGATGGCAAAC -3'

Sequencing Primer
(F):5'- CTTTAGACAAGTAGGCAGCCTGTAAC -3'
(R):5'- GTGGATGGCAAACCTGAATATTTTCC -3'
Posted On2020-07-13