Incidental Mutation 'R0720:Rxfp2'
ID63516
Institutional Source Beutler Lab
Gene Symbol Rxfp2
Ensembl Gene ENSMUSG00000053368
Gene Namerelaxin/insulin-like family peptide receptor 2
SynonymsGpr106, Great, LGR8
MMRRC Submission 038902-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0720 (G1)
Quality Score185
Status Validated
Chromosome5
Chromosomal Location150018675-150082184 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 150044119 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 148 (K148N)
Ref Sequence ENSEMBL: ENSMUSP00000144536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065745] [ENSMUST00000110496] [ENSMUST00000201612]
Predicted Effect probably benign
Transcript: ENSMUST00000065745
AA Change: K148N

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000067897
Gene: ENSMUSG00000053368
AA Change: K148N

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LDLa 27 65 2.55e-11 SMART
LRRNT 93 124 3.83e0 SMART
LRR 120 142 1.71e2 SMART
LRR 143 166 6.77e0 SMART
LRR_TYP 167 190 2.84e-5 SMART
LRR 191 214 7.36e0 SMART
LRR 215 238 1.26e1 SMART
LRR 239 262 2.61e1 SMART
LRR 263 286 8.98e1 SMART
LRR_TYP 287 310 2.24e-3 SMART
LRR 311 334 1.15e1 SMART
LRR 335 358 2.14e1 SMART
Pfam:7tm_1 415 674 1.4e-26 PFAM
low complexity region 682 695 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110496
AA Change: K148N

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000106122
Gene: ENSMUSG00000053368
AA Change: K148N

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LDLa 27 65 2.55e-11 SMART
LRRNT 93 124 3.83e0 SMART
LRR 120 142 1.71e2 SMART
LRR 143 166 6.77e0 SMART
LRR_TYP 167 190 2.84e-5 SMART
LRR 191 214 7.36e0 SMART
LRR 215 238 1.26e1 SMART
LRR 239 262 2.61e1 SMART
LRR 263 286 2.82e0 SMART
LRR 287 310 1.15e1 SMART
LRR 311 334 2.14e1 SMART
Pfam:7tm_1 391 650 1.5e-27 PFAM
low complexity region 658 671 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143989
Predicted Effect probably benign
Transcript: ENSMUST00000201612
AA Change: K148N

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000144536
Gene: ENSMUSG00000053368
AA Change: K148N

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LDLa 27 65 1.3e-13 SMART
LRRNT 93 124 1.9e-2 SMART
LRR 120 142 7.4e-1 SMART
LRR 143 166 2.9e-2 SMART
LRR_TYP 167 190 1.2e-7 SMART
LRR 229 252 5.4e-2 SMART
LRR 253 276 1.1e-1 SMART
LRR 277 300 1.2e-2 SMART
LRR 301 324 5e-2 SMART
LRR 325 348 9.3e-2 SMART
Pfam:7tm_1 405 664 1.5e-24 PFAM
low complexity region 672 685 N/A INTRINSIC
Meta Mutation Damage Score 0.0697 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 95.9%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GPCR (G protein-coupled, 7-transmembrane receptor) family. Mutations in this gene are associated with cryptorchidism. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Oct 2009]
PHENOTYPE: Male homozygotes for a targeted null mutation exhibit bilateral intraabdominal cryptorchidism and sterility associated with a failure in the differentiation of the gubernaculae, ligaments that control testicular movement during development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf2 A G 17: 42,713,172 I136T probably damaging Het
Bbs7 T C 3: 36,592,423 D416G probably damaging Het
Commd4 G T 9: 57,155,434 D179E probably benign Het
Cyp3a57 T C 5: 145,390,403 probably benign Het
Dnah5 A G 15: 28,313,861 N1941S probably null Het
Dynap T C 18: 70,240,984 D157G unknown Het
Eri3 T C 4: 117,553,045 probably null Het
Fam189a1 A G 7: 64,819,910 probably benign Het
Fbxo25 A G 8: 13,935,222 Y305C probably damaging Het
Flt4 C T 11: 49,636,339 probably benign Het
Fxr2 A G 11: 69,639,415 D36G probably benign Het
Gas2l3 T C 10: 89,413,943 T438A probably benign Het
Gcm1 A T 9: 78,064,641 Y288F possibly damaging Het
Gm3164 C A 14: 4,442,719 S218R probably benign Het
Hipk2 C T 6: 38,698,556 R1029H probably damaging Het
Htra3 T C 5: 35,654,109 I392M probably damaging Het
Kansl1l T C 1: 66,801,356 M262V possibly damaging Het
Lrrc47 T C 4: 154,019,887 probably null Het
Macf1 A T 4: 123,432,925 N4926K probably damaging Het
Mllt10 T C 2: 18,196,595 S631P probably benign Het
Nlrp14 A G 7: 107,182,013 H139R probably benign Het
Olfr1153 A T 2: 87,896,669 T157S probably benign Het
Olfr394 T A 11: 73,887,862 N170I probably benign Het
Ptger2 T C 14: 44,989,133 C57R probably benign Het
Rhot1 T C 11: 80,223,943 V59A probably damaging Het
Rmdn2 G A 17: 79,668,029 probably null Het
Sec23a G A 12: 58,971,271 T623M probably damaging Het
Smcr8 T C 11: 60,778,443 L139P probably damaging Het
Spag6l A T 16: 16,767,096 probably benign Het
Taar1 T C 10: 23,921,073 I223T probably damaging Het
Tdo2 G T 3: 81,962,758 A269E probably damaging Het
Tnfsf18 A G 1: 161,503,587 Y102C possibly damaging Het
Tns1 A G 1: 73,925,581 L1297P probably benign Het
Txndc8 C T 4: 57,984,245 probably benign Het
Ubr5 T C 15: 37,972,991 N2622S probably damaging Het
Vmn2r99 T A 17: 19,379,043 F330I probably benign Het
Zdhhc2 T A 8: 40,472,907 probably null Het
Other mutations in Rxfp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00832:Rxfp2 APN 5 150066428 missense probably benign
IGL00984:Rxfp2 APN 5 150067132 missense probably benign 0.24
IGL02475:Rxfp2 APN 5 150063686 missense probably benign 0.07
IGL02637:Rxfp2 APN 5 150055913 missense probably damaging 0.99
IGL02992:Rxfp2 APN 5 150051556 missense probably benign 0.01
IGL03052:Rxfp2 APN 5 150043180 splice site probably benign
IGL03203:Rxfp2 APN 5 150063680 missense probably benign 0.08
R0158:Rxfp2 UTSW 5 150051628 missense probably benign 0.14
R0394:Rxfp2 UTSW 5 150067388 missense probably benign 0.03
R0499:Rxfp2 UTSW 5 150066415 missense probably damaging 1.00
R0576:Rxfp2 UTSW 5 150038247 missense probably benign 0.01
R1172:Rxfp2 UTSW 5 150051556 missense probably benign 0.01
R1173:Rxfp2 UTSW 5 150051556 missense probably benign 0.01
R1174:Rxfp2 UTSW 5 150051556 missense probably benign 0.01
R1175:Rxfp2 UTSW 5 150051556 missense probably benign 0.01
R1606:Rxfp2 UTSW 5 150059897 missense probably benign
R1720:Rxfp2 UTSW 5 150043099 nonsense probably null
R2040:Rxfp2 UTSW 5 150070212 missense probably benign
R3029:Rxfp2 UTSW 5 150043130 missense probably benign 0.05
R3905:Rxfp2 UTSW 5 150055985 splice site probably null
R4056:Rxfp2 UTSW 5 150051633 critical splice donor site probably null
R4156:Rxfp2 UTSW 5 150051555 missense probably benign 0.01
R4282:Rxfp2 UTSW 5 150070270 missense possibly damaging 0.94
R4418:Rxfp2 UTSW 5 150048800 missense probably benign
R4935:Rxfp2 UTSW 5 150051632 critical splice donor site probably null
R5010:Rxfp2 UTSW 5 150067360 missense probably damaging 1.00
R5286:Rxfp2 UTSW 5 150035444 missense probably damaging 1.00
R5373:Rxfp2 UTSW 5 150070260 missense probably benign 0.21
R5374:Rxfp2 UTSW 5 150070260 missense probably benign 0.21
R5530:Rxfp2 UTSW 5 150056810 missense probably damaging 1.00
R5844:Rxfp2 UTSW 5 150043124 missense probably benign 0.00
R6021:Rxfp2 UTSW 5 150063737 missense possibly damaging 0.46
R6211:Rxfp2 UTSW 5 150044126 splice site probably null
R6401:Rxfp2 UTSW 5 150043130 missense probably benign
R6841:Rxfp2 UTSW 5 150018745 start gained probably benign
R6981:Rxfp2 UTSW 5 150048848 splice site probably null
R7012:Rxfp2 UTSW 5 150081194 missense probably benign 0.00
R7032:Rxfp2 UTSW 5 150070348 missense probably damaging 1.00
R7151:Rxfp2 UTSW 5 150043107 missense probably benign 0.01
R7205:Rxfp2 UTSW 5 150059899 missense probably benign 0.05
R7205:Rxfp2 UTSW 5 150059903 missense probably benign 0.00
R7209:Rxfp2 UTSW 5 150053098 intron probably null
R7468:Rxfp2 UTSW 5 150067336 missense possibly damaging 0.70
R7475:Rxfp2 UTSW 5 150049581 missense possibly damaging 0.94
X0067:Rxfp2 UTSW 5 150051618 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGATCTGTAGTCGTGTCCTCAC -3'
(R):5'- ACTGAAGGCTCATCACTGCTCTCC -3'

Sequencing Primer
(F):5'- TCTTGACCTATTCAGAGATAAGAGAG -3'
(R):5'- Tcaccaccaccaccacc -3'
Posted On2013-07-30