Incidental Mutation 'R8191:1110004E09Rik'
ID635184
Institutional Source Beutler Lab
Gene Symbol 1110004E09Rik
Ensembl Gene ENSMUSG00000022972
Gene NameRIKEN cDNA 1110004E09 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.215) question?
Stock #R8191 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location90925809-90935114 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 90931001 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 100 (N100K)
Ref Sequence ENSEMBL: ENSMUSP00000023694 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023694] [ENSMUST00000125519] [ENSMUST00000142340] [ENSMUST00000149833]
Predicted Effect probably damaging
Transcript: ENSMUST00000023694
AA Change: N100K

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000023694
Gene: ENSMUSG00000022972
AA Change: N100K

DomainStartEndE-ValueType
Pfam:DUF2870 189 285 4.7e-47 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000125519
AA Change: N100K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000129345
SMART Domains Protein: ENSMUSP00000122163
Gene: ENSMUSG00000022972

DomainStartEndE-ValueType
Pfam:DUF2870 87 122 6.2e-17 PFAM
Pfam:DUF2870 118 151 4.8e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000142340
AA Change: N56K

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect possibly damaging
Transcript: ENSMUST00000149833
AA Change: N83K

PolyPhen 2 Score 0.679 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000123417
Gene: ENSMUSG00000022972
AA Change: N83K

DomainStartEndE-ValueType
Pfam:DUF2870 171 198 5.8e-14 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene a protein plays a critical role in dynein arm assembly and motile cilia function. Mutations in this gene result in primary ciliary dyskinesia. [provided by RefSeq, Nov 2013]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700037C18Rik G A 16: 3,907,054 R49W probably damaging Het
Adamts4 T C 1: 171,252,723 S282P Het
AI314180 A T 4: 58,872,587 probably null Het
Aqp4 A G 18: 15,398,165 S180P probably benign Het
Armc2 T G 10: 41,963,751 E406A probably benign Het
Atp13a3 A T 16: 30,349,780 Y464N probably damaging Het
B3gnt3 C A 8: 71,693,478 V136L probably benign Het
Cacna1s C T 1: 136,108,155 H1378Y probably damaging Het
Ccnk A T 12: 108,193,674 E138D probably benign Het
Cenpe A G 3: 135,251,614 K1878E probably benign Het
Cep57l1 T A 10: 41,740,959 I111L probably damaging Het
Copg2 T C 6: 30,813,730 I509V probably benign Het
Cux2 T A 5: 121,874,154 D406V probably benign Het
Cyp2a12 G T 7: 27,031,104 A165S probably benign Het
Dnaaf5 T G 5: 139,181,495 S719A probably benign Het
Dnah7c A G 1: 46,607,458 I1220V possibly damaging Het
Dnajb8 C T 6: 88,222,958 R159C possibly damaging Het
Dusp10 T A 1: 184,037,552 D238E possibly damaging Het
Dync1li1 C A 9: 114,709,185 D203E probably benign Het
Eif5b T C 1: 38,036,202 S587P probably damaging Het
Ephb2 G A 4: 136,658,945 T832I probably damaging Het
Exoc1 T A 5: 76,559,827 probably null Het
Fam193a T A 5: 34,440,573 N571K probably damaging Het
Fem1a T A 17: 56,258,356 I483N probably damaging Het
Fgf20 C A 8: 40,308,320 probably benign Het
Fkbp1a C T 2: 151,557,436 P98S Het
Gm9833 G T 3: 10,088,854 V228F probably damaging Het
Gpsm3 A T 17: 34,590,477 D19V probably benign Het
Ido2 C A 8: 24,533,680 G381W probably damaging Het
Ifi204 T C 1: 173,751,660 T540A possibly damaging Het
Isl1 A T 13: 116,305,418 M93K probably benign Het
Map3k10 T A 7: 27,663,246 S472C probably damaging Het
Mcrs1 A T 15: 99,243,325 V432E probably damaging Het
Metap2 A G 10: 93,865,405 probably null Het
Muc5b A G 7: 141,867,684 S4304G probably benign Het
Nell1 T C 7: 50,448,874 V308A unknown Het
Olfr1511 A G 14: 52,390,530 V81A probably benign Het
Olfr984 A T 9: 40,101,471 H6Q probably benign Het
Plxna4 C A 6: 32,516,950 V244F possibly damaging Het
Pnpla6 T C 8: 3,542,382 S1224P probably benign Het
Ripk4 A G 16: 97,763,526 probably benign Het
Rnpep T C 1: 135,272,434 E261G possibly damaging Het
Robo1 C A 16: 72,933,254 S194R probably damaging Het
Rpusd1 C G 17: 25,728,637 Y99* probably null Het
Scarf1 T C 11: 75,522,239 M437T probably benign Het
Sh3tc2 G T 18: 61,973,358 D153Y probably damaging Het
Siglec1 T C 2: 131,085,679 Y69C probably damaging Het
Slc25a34 T C 4: 141,620,584 Y262C probably damaging Het
Srrm2 T A 17: 23,820,245 N1954K probably damaging Het
St6galnac2 T C 11: 116,681,922 Y236C probably damaging Het
Stac3 T A 10: 127,508,199 I322N probably damaging Het
Tcaf1 T C 6: 42,675,256 Q764R probably damaging Het
Tcf20 G A 15: 82,853,405 R1282* probably null Het
Tlr2 T A 3: 83,836,514 K754M probably damaging Het
Tlr2 T G 3: 83,836,515 K754Q probably damaging Het
Tnn C T 1: 160,125,518 V651M probably damaging Het
Ttn T C 2: 76,870,739 H9622R unknown Het
Tubgcp6 C T 15: 89,120,640 G259S probably damaging Het
Ubr5 C A 15: 38,006,507 C1174F Het
Ugt2b35 T A 5: 87,001,443 S184R probably damaging Het
Vit C T 17: 78,546,399 H25Y probably benign Het
Vmn1r177 G A 7: 23,866,311 Q47* probably null Het
Vmn2r104 A T 17: 20,030,203 V602D possibly damaging Het
Vmn2r115 A G 17: 23,359,556 T668A probably damaging Het
Vmn2r125 T G 4: 156,351,414 C362W probably damaging Het
Vwa7 A G 17: 35,019,736 T267A probably damaging Het
Wdr63 G T 3: 146,094,311 P158H probably damaging Het
Xpa C A 4: 46,183,225 R188L possibly damaging Het
Zfp143 C T 7: 110,077,157 T249I probably damaging Het
Zfp607a A G 7: 27,879,443 E646G possibly damaging Het
Zfp729a A T 13: 67,621,719 S130R probably benign Het
Zswim3 C A 2: 164,820,208 Q203K probably damaging Het
Other mutations in 1110004E09Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01338:1110004E09Rik APN 16 90926048 missense possibly damaging 0.60
IGL02607:1110004E09Rik APN 16 90929947 missense probably damaging 1.00
IGL02826:1110004E09Rik APN 16 90926062 missense probably benign 0.02
R0920:1110004E09Rik UTSW 16 90927379 missense probably damaging 0.98
R4586:1110004E09Rik UTSW 16 90927426 missense probably damaging 1.00
R5415:1110004E09Rik UTSW 16 90926065 missense probably benign 0.05
R5443:1110004E09Rik UTSW 16 90927211 missense probably benign
R8114:1110004E09Rik UTSW 16 90934657 missense probably benign
R8699:1110004E09Rik UTSW 16 90931057 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GCGTTTCAGAGTGCAATCAAG -3'
(R):5'- TAGTGATCACAGCTGAAGGC -3'

Sequencing Primer
(F):5'- CAGAGTGCAATCAAGTCTTCAG -3'
(R):5'- TGCCCTCGACTTGTTTTTCAGAG -3'
Posted On2020-07-13