Incidental Mutation 'R8191:1110004E09Rik'
ID 635184
Institutional Source Beutler Lab
Gene Symbol 1110004E09Rik
Ensembl Gene ENSMUSG00000022972
Gene Name RIKEN cDNA 1110004E09 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.167) question?
Stock # R8191 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 90925809-90935114 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 90931001 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 100 (N100K)
Ref Sequence ENSEMBL: ENSMUSP00000023694 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023694] [ENSMUST00000125519] [ENSMUST00000142340] [ENSMUST00000149833]
AlphaFold Q8BL95
Predicted Effect probably damaging
Transcript: ENSMUST00000023694
AA Change: N100K

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000023694
Gene: ENSMUSG00000022972
AA Change: N100K

DomainStartEndE-ValueType
Pfam:DUF2870 189 285 4.7e-47 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000125519
AA Change: N100K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000129345
SMART Domains Protein: ENSMUSP00000122163
Gene: ENSMUSG00000022972

DomainStartEndE-ValueType
Pfam:DUF2870 87 122 6.2e-17 PFAM
Pfam:DUF2870 118 151 4.8e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000142340
AA Change: N56K

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect possibly damaging
Transcript: ENSMUST00000149833
AA Change: N83K

PolyPhen 2 Score 0.679 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000123417
Gene: ENSMUSG00000022972
AA Change: N83K

DomainStartEndE-ValueType
Pfam:DUF2870 171 198 5.8e-14 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene a protein plays a critical role in dynein arm assembly and motile cilia function. Mutations in this gene result in primary ciliary dyskinesia. [provided by RefSeq, Nov 2013]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700037C18Rik G A 16: 3,907,054 R49W probably damaging Het
Adamts4 T C 1: 171,252,723 S282P Het
AI314180 A T 4: 58,872,587 probably null Het
Aqp4 A G 18: 15,398,165 S180P probably benign Het
Armc2 T G 10: 41,963,751 E406A probably benign Het
Atp13a3 A T 16: 30,349,780 Y464N probably damaging Het
B3gnt3 C A 8: 71,693,478 V136L probably benign Het
Cacna1s C T 1: 136,108,155 H1378Y probably damaging Het
Ccnk A T 12: 108,193,674 E138D probably benign Het
Cenpe A G 3: 135,251,614 K1878E probably benign Het
Cep57l1 T A 10: 41,740,959 I111L probably damaging Het
Copg2 T C 6: 30,813,730 I509V probably benign Het
Cux2 T A 5: 121,874,154 D406V probably benign Het
Cyp2a12 G T 7: 27,031,104 A165S probably benign Het
Dnaaf5 T G 5: 139,181,495 S719A probably benign Het
Dnah7c A G 1: 46,607,458 I1220V possibly damaging Het
Dnajb8 C T 6: 88,222,958 R159C possibly damaging Het
Dusp10 T A 1: 184,037,552 D238E possibly damaging Het
Dync1li1 C A 9: 114,709,185 D203E probably benign Het
Eif5b T C 1: 38,036,202 S587P probably damaging Het
Ephb2 G A 4: 136,658,945 T832I probably damaging Het
Exoc1 T A 5: 76,559,827 probably null Het
Fam193a T A 5: 34,440,573 N571K probably damaging Het
Fem1a T A 17: 56,258,356 I483N probably damaging Het
Fgf20 C A 8: 40,308,320 probably benign Het
Fkbp1a C T 2: 151,557,436 P98S Het
Gm9833 G T 3: 10,088,854 V228F probably damaging Het
Gpsm3 A T 17: 34,590,477 D19V probably benign Het
Ido2 C A 8: 24,533,680 G381W probably damaging Het
Ifi204 T C 1: 173,751,660 T540A possibly damaging Het
Isl1 A T 13: 116,305,418 M93K probably benign Het
Map3k10 T A 7: 27,663,246 S472C probably damaging Het
Mcrs1 A T 15: 99,243,325 V432E probably damaging Het
Metap2 A G 10: 93,865,405 probably null Het
Muc5b A G 7: 141,867,684 S4304G probably benign Het
Nell1 T C 7: 50,448,874 V308A unknown Het
Olfr1511 A G 14: 52,390,530 V81A probably benign Het
Olfr984 A T 9: 40,101,471 H6Q probably benign Het
Plxna4 C A 6: 32,516,950 V244F possibly damaging Het
Pnpla6 T C 8: 3,542,382 S1224P probably benign Het
Ripk4 A G 16: 97,763,526 probably benign Het
Rnpep T C 1: 135,272,434 E261G possibly damaging Het
Robo1 C A 16: 72,933,254 S194R probably damaging Het
Rpusd1 C G 17: 25,728,637 Y99* probably null Het
Scarf1 T C 11: 75,522,239 M437T probably benign Het
Sh3tc2 G T 18: 61,973,358 D153Y probably damaging Het
Siglec1 T C 2: 131,085,679 Y69C probably damaging Het
Slc25a34 T C 4: 141,620,584 Y262C probably damaging Het
Srrm2 T A 17: 23,820,245 N1954K probably damaging Het
St6galnac2 T C 11: 116,681,922 Y236C probably damaging Het
Stac3 T A 10: 127,508,199 I322N probably damaging Het
Tcaf1 T C 6: 42,675,256 Q764R probably damaging Het
Tcf20 G A 15: 82,853,405 R1282* probably null Het
Tlr2 T A 3: 83,836,514 K754M probably damaging Het
Tlr2 T G 3: 83,836,515 K754Q probably damaging Het
Tnn C T 1: 160,125,518 V651M probably damaging Het
Ttn T C 2: 76,870,739 H9622R unknown Het
Tubgcp6 C T 15: 89,120,640 G259S probably damaging Het
Ubr5 C A 15: 38,006,507 C1174F Het
Ugt2b35 T A 5: 87,001,443 S184R probably damaging Het
Vit C T 17: 78,546,399 H25Y probably benign Het
Vmn1r177 G A 7: 23,866,311 Q47* probably null Het
Vmn2r104 A T 17: 20,030,203 V602D possibly damaging Het
Vmn2r115 A G 17: 23,359,556 T668A probably damaging Het
Vmn2r125 T G 4: 156,351,414 C362W probably damaging Het
Vwa7 A G 17: 35,019,736 T267A probably damaging Het
Wdr63 G T 3: 146,094,311 P158H probably damaging Het
Xpa C A 4: 46,183,225 R188L possibly damaging Het
Zfp143 C T 7: 110,077,157 T249I probably damaging Het
Zfp607a A G 7: 27,879,443 E646G possibly damaging Het
Zfp729a A T 13: 67,621,719 S130R probably benign Het
Zswim3 C A 2: 164,820,208 Q203K probably damaging Het
Other mutations in 1110004E09Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01338:1110004E09Rik APN 16 90926048 missense possibly damaging 0.60
IGL02607:1110004E09Rik APN 16 90929947 missense probably damaging 1.00
IGL02826:1110004E09Rik APN 16 90926062 missense probably benign 0.02
R0920:1110004E09Rik UTSW 16 90927379 missense probably damaging 0.98
R4586:1110004E09Rik UTSW 16 90927426 missense probably damaging 1.00
R5415:1110004E09Rik UTSW 16 90926065 missense probably benign 0.05
R5443:1110004E09Rik UTSW 16 90927211 missense probably benign
R8114:1110004E09Rik UTSW 16 90934657 missense probably benign
R8699:1110004E09Rik UTSW 16 90931057 missense probably benign 0.03
R8876:1110004E09Rik UTSW 16 90927393 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- GCGTTTCAGAGTGCAATCAAG -3'
(R):5'- TAGTGATCACAGCTGAAGGC -3'

Sequencing Primer
(F):5'- CAGAGTGCAATCAAGTCTTCAG -3'
(R):5'- TGCCCTCGACTTGTTTTTCAGAG -3'
Posted On 2020-07-13