Mutagenetix > Incidental Mutations

Incidental Mutation 'R8192:Pikfyve'

635196

Institutional Source

Beutler Lab

Gene Symbol

Pikfyve

Ensembl Gene

ENSMUSG00000025949

Gene Name

phosphoinositide kinase, FYVE type zinc finger containing

Synonyms

Pip5k3

MMRRC Submission

Accession Numbers

Genbank: NM_011086

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R8192 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

65186683-65278695 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 65246395 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 931 (E931G)

Ref Sequence

ENSEMBL: ENSMUSP00000095314 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000081154] [ENSMUST00000097707] [ENSMUST00000190058]

AlphaFold

Q9Z1T6

Predicted Effect

probably damaging
Transcript: ENSMUST00000081154
AA Change: E886G

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000079926
Gene: ENSMUSG00000025949
AA Change: E886G

Domain	Start	End	E-Value	Type
low complexity region	58	81	N/A	INTRINSIC
FYVE	161	230	5.95e-18	SMART
DEP	376	451	9.05e-27	SMART
Pfam:Cpn60_TCP1	547	822	2e-37	PFAM
low complexity region	1177	1189	N/A	INTRINSIC
low complexity region	1516	1536	N/A	INTRINSIC
PIPKc	1745	2039	3.03e-162	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000097707
AA Change: E931G

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000095314
Gene: ENSMUSG00000025949
AA Change: E931G

Domain	Start	End	E-Value	Type
low complexity region	58	81	N/A	INTRINSIC
FYVE	150	219	5.95e-18	SMART
DEP	365	440	9.05e-27	SMART
Pfam:Cpn60_TCP1	590	864	1.8e-35	PFAM
low complexity region	1222	1234	N/A	INTRINSIC
low complexity region	1561	1581	N/A	INTRINSIC
PIPKc	1790	2084	3.03e-162	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000190058

SMART Domains

Protein: ENSMUSP00000140204
Gene: ENSMUSG00000025949

Domain	Start	End	E-Value	Type
low complexity region	58	81	N/A	INTRINSIC

Meta Mutation Damage Score

0.1057

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.0%

Validation Efficiency

100% (64/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphorylated derivatives of phosphatidylinositol (PtdIns) regulate cytoskeletal functions, membrane trafficking, and receptor signaling by recruiting protein complexes to cell- and endosomal-membranes. Humans have multiple PtdIns proteins that differ by the degree and position of phosphorylation of the inositol ring. This gene encodes an enzyme (PIKfyve; also known as phosphatidylinositol-3-phosphate 5-kinase type III or PIPKIII) that phosphorylates the D-5 position in PtdIns and phosphatidylinositol-3-phosphate (PtdIns3P) to make PtdIns5P and PtdIns(3,5)biphosphate. The D-5 position also can be phosphorylated by type I PtdIns4P-5-kinases (PIP5Ks) that are encoded by distinct genes and preferentially phosphorylate D-4 phosphorylated PtdIns. In contrast, PIKfyve preferentially phosphorylates D-3 phosphorylated PtdIns. In addition to being a lipid kinase, PIKfyve also has protein kinase activity. PIKfyve regulates endomembrane homeostasis and plays a role in the biogenesis of endosome carrier vesicles from early endosomes. Mutations in this gene cause corneal fleck dystrophy (CFD); an autosomal dominant disorder characterized by numerous small white flecks present in all layers of the corneal stroma. Histologically, these flecks appear to be keratocytes distended with lipid and mucopolysaccharide filled intracytoplasmic vacuoles. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a null allele die prior to implantation with reduced numbers of inner cell mass and trophectoderm cells and blastocoele abnormalities. Mice homozygous for a second null allele show embryonic lethality between somite formation and embryo turning with abnormal visceral endoderm. [provided by MGI curators]

Allele List at MGI

All alleles(16) : Gene trapped(16)

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam34	A	T	8: 43,650,933	D558E	probably damaging	Het
Alox15	T	A	11: 70,350,910	E48D	probably benign	Het
Alyref	T	C	11: 120,597,696	E102G	probably benign	Het
Bach2	A	G	4: 32,562,294	S254G	probably benign	Het
BC080695	T	G	4: 143,571,960	Y158D	probably benign	Het
Bcl2l13	A	G	6: 120,876,306	E184G	possibly damaging	Het
Best1	T	A	19: 9,986,300	I506F	possibly damaging	Het
Cd177	T	A	7: 24,754,302	D388V	probably benign	Het
Cep350	T	C	1: 155,940,783	K329E	possibly damaging	Het
Clasrp	T	C	7: 19,595,462	N65S	possibly damaging	Het
Cobl	T	C	11: 12,249,745	R1301G	probably benign	Het
Cul9	T	C	17: 46,538,347	E624G	probably benign	Het
Cyp21a1	A	T	17: 34,803,659	Y109N	probably damaging	Het
Dbf4	A	G	5: 8,398,134	S359P	probably benign	Het
Ddx60	A	G	8: 61,977,968	T846A	probably damaging	Het
Dnah11	A	G	12: 118,012,446	V2746A	probably benign	Het
Dnah12	G	A	14: 26,706,881	A221T	probably benign	Het
Dnajb8	C	T	6: 88,222,958	R159C	possibly damaging	Het
Dock2	A	G	11: 34,732,339		probably null	Het
Dpy19l1	T	C	9: 24,450,727	I119V	possibly damaging	Het
Dsg1c	A	G	18: 20,266,198	T120A	probably damaging	Het
Dzank1	T	C	2: 144,490,225	H397R	probably benign	Het
Fam35a	A	T	14: 34,245,216	S680T	probably benign	Het
Gaa	G	T	11: 119,270,409	A93S	possibly damaging	Het
Galnt4	G	A	10: 99,109,256	R281H	probably benign	Het
Gm13103	G	A	4: 143,851,539	W123*	probably null	Het
Gm3250	T	C	10: 77,782,457	E29G	unknown	Het
Gm5065	T	A	7: 5,359,596	D75E	possibly damaging	Het
H13	T	G	2: 152,669,602	D7E	probably benign	Het
H60c	T	A	10: 3,259,781	I140F	probably benign	Het
Hsd3b2	T	C	3: 98,713,592	N49S	probably benign	Het
Klhl11	G	T	11: 100,464,096	P300T	probably benign	Het
Knop1	C	A	7: 118,853,146	V117L		Het
Lrrc38	G	A	4: 143,350,733	G189R	probably damaging	Het
Lrrc9	A	T	12: 72,449,389	I13F	probably damaging	Het
Macf1	A	G	4: 123,440,597	S4456P	probably damaging	Het
Mkrn1	A	T	6: 39,399,355	V439D	probably damaging	Het
Muc2	T	A	7: 141,751,478	V612D		Het
Nrxn3	A	G	12: 90,204,795	N967D	probably benign	Het
Olfr1173	A	C	2: 88,274,944	V35G	probably damaging	Het
Olfr978	T	A	9: 39,994,171	D120E	probably damaging	Het
Oprm1	C	T	10: 6,838,417	P391S	probably benign	Het
Parp14	T	A	16: 35,871,214	E47V	probably benign	Het
Plcz1	A	T	6: 140,023,260	C151S	probably damaging	Het
Rbm26	A	G	14: 105,142,689		probably null	Het
Rffl	G	T	11: 82,812,723		probably null	Het
Sc5d	T	C	9: 42,259,798	I32V	probably benign	Het
Scube1	A	G	15: 83,629,382		probably null	Het
Slc12a6	A	G	2: 112,351,377	Y714C	probably damaging	Het
Slc26a3	A	G	12: 31,468,542	I670V	probably benign	Het
Slc8a3	A	T	12: 81,199,681	V866D	probably damaging	Het
Slco3a1	A	T	7: 74,320,590	M423K	probably benign	Het
Smc6	A	G	12: 11,299,335	E773G	probably benign	Het
Son	A	G	16: 91,655,549	T395A	possibly damaging	Het
Ss18l1	T	C	2: 180,059,362	S290P	probably damaging	Het
Tcof1	A	C	18: 60,843,303	V78G	probably damaging	Het
Thsd1	G	A	8: 22,243,902	V322M	probably benign	Het
Tln2	A	T	9: 67,346,529	C753*	probably null	Het
Trav6n-6	T	A	14: 53,133,040	F83I	probably damaging	Het
Ttc39d	A	G	17: 80,216,578	H222R	probably damaging	Het
Ugt2b35	T	A	5: 87,001,443	S184R	probably damaging	Het
Upf1	A	G	8: 70,340,644	L288P	probably benign	Het
Zfp442	T	C	2: 150,408,709	I424M	unknown	Het
Zfp580	T	C	7: 5,053,115	V100A	probably benign	Het
Zfpm1	C	A	8: 122,332,094	P151Q	probably damaging	Het
Zfr2	C	T	10: 81,242,815	P294S	possibly damaging	Het

Other mutations in Pikfyve

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00162:Pikfyve	APN	1	65260121	critical splice donor site	probably null
IGL01135:Pikfyve	APN	1	65251635	missense	probably damaging	0.96
IGL01511:Pikfyve	APN	1	65258869	nonsense	probably null
IGL01759:Pikfyve	APN	1	65253353	missense	probably benign	0.06
IGL01888:Pikfyve	APN	1	65223640	missense	probably damaging	1.00
IGL01967:Pikfyve	APN	1	65264365	missense	possibly damaging	0.89
IGL02055:Pikfyve	APN	1	65238544	critical splice donor site	probably null
IGL02119:Pikfyve	APN	1	65272571	missense	probably damaging	1.00
IGL02141:Pikfyve	APN	1	65246397	missense	probably benign	0.13
IGL02207:Pikfyve	APN	1	65251678	critical splice donor site	probably null
IGL02380:Pikfyve	APN	1	65256021	missense	probably damaging	0.99
IGL02400:Pikfyve	APN	1	65252569	missense	probably damaging	1.00
IGL02403:Pikfyve	APN	1	65244504	missense	probably damaging	0.99
IGL02426:Pikfyve	APN	1	65251612	missense	possibly damaging	0.77
IGL02496:Pikfyve	APN	1	65264376	missense	possibly damaging	0.94
IGL02573:Pikfyve	APN	1	65230855	critical splice donor site	probably null
IGL02746:Pikfyve	APN	1	65234272	missense	probably damaging	1.00
IGL02814:Pikfyve	APN	1	65250194	nonsense	probably null
IGL02890:Pikfyve	APN	1	65230797	missense	probably benign	0.00
IGL03102:Pikfyve	APN	1	65252467	nonsense	probably null
IGL03294:Pikfyve	APN	1	65247067	missense	probably damaging	1.00
falcon	UTSW	1	65196741	missense	probably damaging	1.00
oompa	UTSW	1	65196706	missense	probably damaging	1.00
wonka	UTSW	1	65196706	missense	probably damaging	1.00
G5538:Pikfyve	UTSW	1	65202916	missense	probably damaging	1.00
R0031:Pikfyve	UTSW	1	65215929	splice site	probably benign
R0196:Pikfyve	UTSW	1	65256072	missense	possibly damaging	0.92
R0212:Pikfyve	UTSW	1	65262905	missense	probably benign	0.41
R0319:Pikfyve	UTSW	1	65246331	missense	probably benign	0.01
R0332:Pikfyve	UTSW	1	65264399	missense	probably benign	0.02
R0389:Pikfyve	UTSW	1	65196706	missense	probably damaging	1.00
R0443:Pikfyve	UTSW	1	65196706	missense	probably damaging	1.00
R0503:Pikfyve	UTSW	1	65219899	missense	probably damaging	0.97
R0722:Pikfyve	UTSW	1	65253523	missense	probably damaging	0.99
R0906:Pikfyve	UTSW	1	65253397	missense	probably damaging	1.00
R0907:Pikfyve	UTSW	1	65202830	missense	possibly damaging	0.64
R0970:Pikfyve	UTSW	1	65265824	missense	probably damaging	0.99
R1188:Pikfyve	UTSW	1	65246959	missense	possibly damaging	0.46
R1412:Pikfyve	UTSW	1	65202830	missense	possibly damaging	0.64
R1421:Pikfyve	UTSW	1	65271311	missense	probably damaging	1.00
R1468:Pikfyve	UTSW	1	65251666	missense	probably damaging	0.98
R1468:Pikfyve	UTSW	1	65251666	missense	probably damaging	0.98
R1472:Pikfyve	UTSW	1	65224201	missense	probably damaging	0.96
R1478:Pikfyve	UTSW	1	65262977	critical splice donor site	probably null
R1501:Pikfyve	UTSW	1	65265284	missense	possibly damaging	0.84
R1757:Pikfyve	UTSW	1	65252548	missense	probably damaging	0.99
R1773:Pikfyve	UTSW	1	65192271	missense	probably damaging	0.99
R1773:Pikfyve	UTSW	1	65246370	missense	probably benign
R1795:Pikfyve	UTSW	1	65252557	missense	probably damaging	1.00
R1855:Pikfyve	UTSW	1	65258798	missense	probably benign	0.03
R1905:Pikfyve	UTSW	1	65192295	critical splice donor site	probably null
R1995:Pikfyve	UTSW	1	65246708	missense	probably damaging	1.00
R2034:Pikfyve	UTSW	1	65222357	missense	probably damaging	1.00
R2045:Pikfyve	UTSW	1	65253353	missense	probably benign	0.06
R2229:Pikfyve	UTSW	1	65267855	missense	probably damaging	1.00
R2295:Pikfyve	UTSW	1	65246676	missense	probably damaging	0.99
R2913:Pikfyve	UTSW	1	65253517	missense	probably damaging	1.00
R3818:Pikfyve	UTSW	1	65245758	missense	probably damaging	1.00
R3832:Pikfyve	UTSW	1	65244420	missense	probably damaging	0.99
R3850:Pikfyve	UTSW	1	65230845	missense	probably damaging	1.00
R3946:Pikfyve	UTSW	1	65196681	missense	probably damaging	1.00
R4105:Pikfyve	UTSW	1	65190520	unclassified	probably benign
R4542:Pikfyve	UTSW	1	65244430	missense	probably damaging	1.00
R4574:Pikfyve	UTSW	1	65192192	missense	probably damaging	1.00
R4601:Pikfyve	UTSW	1	65234262	missense	probably damaging	1.00
R4667:Pikfyve	UTSW	1	65250273	missense	probably damaging	1.00
R4668:Pikfyve	UTSW	1	65250273	missense	probably damaging	1.00
R4669:Pikfyve	UTSW	1	65250273	missense	probably damaging	1.00
R4707:Pikfyve	UTSW	1	65267846	missense	probably benign
R4716:Pikfyve	UTSW	1	65246476	missense	possibly damaging	0.84
R4758:Pikfyve	UTSW	1	65272515	missense	possibly damaging	0.84
R4784:Pikfyve	UTSW	1	65267846	missense	probably benign
R4785:Pikfyve	UTSW	1	65267846	missense	probably benign
R4805:Pikfyve	UTSW	1	65268800	missense	probably damaging	0.99
R4831:Pikfyve	UTSW	1	65196741	missense	probably damaging	1.00
R4837:Pikfyve	UTSW	1	65246590	missense	possibly damaging	0.92
R5064:Pikfyve	UTSW	1	65253407	missense	probably damaging	1.00
R5115:Pikfyve	UTSW	1	65224117	intron	probably benign
R5265:Pikfyve	UTSW	1	65267829	missense	possibly damaging	0.72
R5279:Pikfyve	UTSW	1	65196699	nonsense	probably null
R5384:Pikfyve	UTSW	1	65244409	missense	probably damaging	1.00
R5387:Pikfyve	UTSW	1	65265268	missense	possibly damaging	0.94
R5461:Pikfyve	UTSW	1	65235033	missense	probably damaging	1.00
R5467:Pikfyve	UTSW	1	65252495	missense	probably damaging	1.00
R5560:Pikfyve	UTSW	1	65253407	missense	probably damaging	1.00
R5575:Pikfyve	UTSW	1	65273730	missense	probably damaging	1.00
R5611:Pikfyve	UTSW	1	65256088	missense	probably damaging	0.96
R5663:Pikfyve	UTSW	1	65216028	missense	probably benign	0.09
R5891:Pikfyve	UTSW	1	65202737	missense	probably damaging	1.00
R5960:Pikfyve	UTSW	1	65253438	nonsense	probably null
R6026:Pikfyve	UTSW	1	65272697	missense	probably damaging	1.00
R6057:Pikfyve	UTSW	1	65272571	missense	probably damaging	1.00
R6101:Pikfyve	UTSW	1	65264345	critical splice acceptor site	probably null
R6105:Pikfyve	UTSW	1	65264345	critical splice acceptor site	probably null
R6161:Pikfyve	UTSW	1	65216043	missense	probably benign	0.36
R6287:Pikfyve	UTSW	1	65253532	critical splice donor site	probably null
R6290:Pikfyve	UTSW	1	65202925	critical splice donor site	probably null
R6296:Pikfyve	UTSW	1	65262953	missense	probably damaging	0.99
R6516:Pikfyve	UTSW	1	65265781	missense	probably benign	0.35
R6835:Pikfyve	UTSW	1	65258843	missense	probably damaging	0.98
R6994:Pikfyve	UTSW	1	65252530	missense	probably damaging	1.00
R6997:Pikfyve	UTSW	1	65246663	missense	probably damaging	1.00
R7038:Pikfyve	UTSW	1	65234361	missense	probably damaging	1.00
R7044:Pikfyve	UTSW	1	65246854	missense	probably benign	0.01
R7057:Pikfyve	UTSW	1	65247205	missense	probably benign	0.00
R7525:Pikfyve	UTSW	1	65244426	nonsense	probably null
R7558:Pikfyve	UTSW	1	65272623	missense	probably benign	0.01
R7625:Pikfyve	UTSW	1	65267877	missense	possibly damaging	0.86
R7807:Pikfyve	UTSW	1	65269942	missense	probably damaging	1.00
R7961:Pikfyve	UTSW	1	65255134	missense	probably damaging	1.00
R8009:Pikfyve	UTSW	1	65255134	missense	probably damaging	1.00
R8154:Pikfyve	UTSW	1	65265789	missense	probably damaging	1.00
R8275:Pikfyve	UTSW	1	65253342	splice site	probably benign
R8307:Pikfyve	UTSW	1	65245735	missense	possibly damaging	0.77
R8710:Pikfyve	UTSW	1	65215996	missense	possibly damaging	0.94
R8867:Pikfyve	UTSW	1	65244417	missense	probably damaging	1.00
R8936:Pikfyve	UTSW	1	65271268	missense	possibly damaging	0.84
R8940:Pikfyve	UTSW	1	65246970	missense	probably benign	0.00
R8995:Pikfyve	UTSW	1	65205587	critical splice acceptor site	probably null
R9092:Pikfyve	UTSW	1	65244400	missense	probably damaging	1.00
R9131:Pikfyve	UTSW	1	65246080	missense	probably damaging	1.00
R9151:Pikfyve	UTSW	1	65196739	missense	probably damaging	1.00
R9210:Pikfyve	UTSW	1	65252560	missense	probably damaging	1.00
R9212:Pikfyve	UTSW	1	65252560	missense	probably damaging	1.00
R9235:Pikfyve	UTSW	1	65260029	missense	probably benign	0.37
R9368:Pikfyve	UTSW	1	65268742	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCATGGATGAGTTCGCTATGCC -3'
(R):5'- TGGGATCCTGTTGCTCATCC -3'

Sequencing Primer
(F):5'- GATGAGTTCGCTATGCCTCCAAC -3'
(R):5'- CATCCGTTTGCTGTGAAGTC -3'

Posted On

2020-07-13