Mutagenetix > Incidental Mutation

Incidental Mutation 'R8192:Cep350'

635197

Institutional Source

Beutler Lab

Gene Symbol

Cep350

Ensembl Gene

ENSMUSG00000033671

Gene Name

centrosomal protein 350

Synonyms

6430546F08Rik, 4933409L06Rik

MMRRC Submission

067615-MU

Accession Numbers

Genbank: NM_001039184.1; Ensembl: ENSMUST00000138762, ENSMUST00000124495, ENSMUST00000078888

Essential gene?

Probably essential (E-score: 0.960) question?

Stock #

R8192 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

155844964-155973255 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 155940783 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 329 (K329E)

Ref Sequence

ENSEMBL: ENSMUSP00000121043 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000124495] [ENSMUST00000138762]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000124495
AA Change: K329E

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000138762
AA Change: K389E

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000120085
Gene: ENSMUSG00000033671
AA Change: K389E

Domain	Start	End	E-Value	Type
low complexity region	251	265	N/A	INTRINSIC
low complexity region	376	394	N/A	INTRINSIC
low complexity region	481	491	N/A	INTRINSIC
coiled coil region	596	641	N/A	INTRINSIC
low complexity region	659	669	N/A	INTRINSIC
low complexity region	701	719	N/A	INTRINSIC
low complexity region	754	763	N/A	INTRINSIC
low complexity region	979	994	N/A	INTRINSIC
low complexity region	1153	1175	N/A	INTRINSIC
low complexity region	1250	1267	N/A	INTRINSIC
coiled coil region	1363	1402	N/A	INTRINSIC
low complexity region	1517	1531	N/A	INTRINSIC
low complexity region	1536	1546	N/A	INTRINSIC
low complexity region	1694	1714	N/A	INTRINSIC
coiled coil region	1732	1794	N/A	INTRINSIC
low complexity region	1800	1811	N/A	INTRINSIC
low complexity region	1819	1835	N/A	INTRINSIC
coiled coil region	1853	1893	N/A	INTRINSIC
low complexity region	1980	1994	N/A	INTRINSIC
coiled coil region	2042	2092	N/A	INTRINSIC
low complexity region	2383	2394	N/A	INTRINSIC
low complexity region	2409	2421	N/A	INTRINSIC
low complexity region	2470	2482	N/A	INTRINSIC
CAP_GLY	2486	2551	5.91e-31	SMART
coiled coil region	2700	2731	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.0%

Validation Efficiency

100% (64/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a large protein with a CAP-Gly domain typically found in cytoskeleton-associated proteins. The encoded protein primarily localizes to the centrosome, a non-membraneous organelle that functions as the major microtubule-organizing center in animal cells. The encoded protein directly interacts with another large centrosomal protein and is required to anchor microtubules at the centrosome. It is also implicated in the regulation of a class of nuclear hormone receptors in the nucleus. Several alternatively spliced transcript variants have been found, but their full-length nature has not been determined. [provided by RefSeq, Jul 2008]

Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam34	A	T	8: 43,650,933	D558E	probably damaging	Het
Alox15	T	A	11: 70,350,910	E48D	probably benign	Het
Alyref	T	C	11: 120,597,696	E102G	probably benign	Het
Bach2	A	G	4: 32,562,294	S254G	probably benign	Het
BC080695	T	G	4: 143,571,960	Y158D	probably benign	Het
Bcl2l13	A	G	6: 120,876,306	E184G	possibly damaging	Het
Best1	T	A	19: 9,986,300	I506F	possibly damaging	Het
Cd177	T	A	7: 24,754,302	D388V	probably benign	Het
Clasrp	T	C	7: 19,595,462	N65S	possibly damaging	Het
Cobl	T	C	11: 12,249,745	R1301G	probably benign	Het
Cul9	T	C	17: 46,538,347	E624G	probably benign	Het
Cyp21a1	A	T	17: 34,803,659	Y109N	probably damaging	Het
Dbf4	A	G	5: 8,398,134	S359P	probably benign	Het
Ddx60	A	G	8: 61,977,968	T846A	probably damaging	Het
Dnah11	A	G	12: 118,012,446	V2746A	probably benign	Het
Dnah12	G	A	14: 26,706,881	A221T	probably benign	Het
Dnajb8	C	T	6: 88,222,958	R159C	possibly damaging	Het
Dock2	A	G	11: 34,732,339		probably null	Het
Dpy19l1	T	C	9: 24,450,727	I119V	possibly damaging	Het
Dsg1c	A	G	18: 20,266,198	T120A	probably damaging	Het
Dzank1	T	C	2: 144,490,225	H397R	probably benign	Het
Fam35a	A	T	14: 34,245,216	S680T	probably benign	Het
Gaa	G	T	11: 119,270,409	A93S	possibly damaging	Het
Galnt4	G	A	10: 99,109,256	R281H	probably benign	Het
Gm13103	G	A	4: 143,851,539	W123*	probably null	Het
Gm3250	T	C	10: 77,782,457	E29G	unknown	Het
Gm5065	T	A	7: 5,359,596	D75E	possibly damaging	Het
H13	T	G	2: 152,669,602	D7E	probably benign	Het
H60c	T	A	10: 3,259,781	I140F	probably benign	Het
Hsd3b2	T	C	3: 98,713,592	N49S	probably benign	Het
Klhl11	G	T	11: 100,464,096	P300T	probably benign	Het
Knop1	C	A	7: 118,853,146	V117L		Het
Lrrc38	G	A	4: 143,350,733	G189R	probably damaging	Het
Lrrc9	A	T	12: 72,449,389	I13F	probably damaging	Het
Macf1	A	G	4: 123,440,597	S4456P	probably damaging	Het
Mkrn1	A	T	6: 39,399,355	V439D	probably damaging	Het
Muc2	T	A	7: 141,751,478	V612D		Het
Nrxn3	A	G	12: 90,204,795	N967D	probably benign	Het
Olfr1173	A	C	2: 88,274,944	V35G	probably damaging	Het
Olfr978	T	A	9: 39,994,171	D120E	probably damaging	Het
Oprm1	C	T	10: 6,838,417	P391S	probably benign	Het
Parp14	T	A	16: 35,871,214	E47V	probably benign	Het
Pikfyve	A	G	1: 65,246,395	E931G	possibly damaging	Het
Plcz1	A	T	6: 140,023,260	C151S	probably damaging	Het
Rbm26	A	G	14: 105,142,689		probably null	Het
Rffl	G	T	11: 82,812,723		probably null	Het
Sc5d	T	C	9: 42,259,798	I32V	probably benign	Het
Scube1	A	G	15: 83,629,382		probably null	Het
Slc12a6	A	G	2: 112,351,377	Y714C	probably damaging	Het
Slc26a3	A	G	12: 31,468,542	I670V	probably benign	Het
Slc8a3	A	T	12: 81,199,681	V866D	probably damaging	Het
Slco3a1	A	T	7: 74,320,590	M423K	probably benign	Het
Smc6	A	G	12: 11,299,335	E773G	probably benign	Het
Son	A	G	16: 91,655,549	T395A	possibly damaging	Het
Ss18l1	T	C	2: 180,059,362	S290P	probably damaging	Het
Tcof1	A	C	18: 60,843,303	V78G	probably damaging	Het
Thsd1	G	A	8: 22,243,902	V322M	probably benign	Het
Tln2	A	T	9: 67,346,529	C753*	probably null	Het
Trav6n-6	T	A	14: 53,133,040	F83I	probably damaging	Het
Ttc39d	A	G	17: 80,216,578	H222R	probably damaging	Het
Ugt2b35	T	A	5: 87,001,443	S184R	probably damaging	Het
Upf1	A	G	8: 70,340,644	L288P	probably benign	Het
Zfp442	T	C	2: 150,408,709	I424M	unknown	Het
Zfp580	T	C	7: 5,053,115	V100A	probably benign	Het
Zfpm1	C	A	8: 122,332,094	P151Q	probably damaging	Het
Zfr2	C	T	10: 81,242,815	P294S	possibly damaging	Het

Other mutations in Cep350

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00764:Cep350	APN	1	155940746	missense	possibly damaging	0.68
IGL00821:Cep350	APN	1	155862204	missense	probably benign
IGL00837:Cep350	APN	1	155953391	missense	probably damaging	1.00
IGL00977:Cep350	APN	1	155932865	missense	probably null	0.99
IGL01544:Cep350	APN	1	155953187	missense	probably damaging	1.00
IGL01616:Cep350	APN	1	155953247	missense	probably benign	0.00
IGL01695:Cep350	APN	1	155944158	missense	probably damaging	1.00
IGL01902:Cep350	APN	1	155861985	missense	probably damaging	1.00
IGL01977:Cep350	APN	1	155911968	missense	probably benign	0.01
IGL02388:Cep350	APN	1	155953753	missense	probably benign	0.28
IGL02475:Cep350	APN	1	155862595	missense	probably damaging	1.00
IGL02528:Cep350	APN	1	155894615	missense	probably damaging	1.00
IGL02598:Cep350	APN	1	155862967	missense	probably benign	0.00
IGL02676:Cep350	APN	1	155862231	missense	possibly damaging	0.82
IGL02728:Cep350	APN	1	155953222	missense	probably benign	0.02
IGL02744:Cep350	APN	1	155931533	missense	probably damaging	0.98
IGL02817:Cep350	APN	1	155928842	missense	probably damaging	1.00
IGL02892:Cep350	APN	1	155868806	missense	possibly damaging	0.51
IGL03156:Cep350	APN	1	155858042	missense	probably damaging	1.00
IGL03166:Cep350	APN	1	155863600	missense	possibly damaging	0.78
IGL03216:Cep350	APN	1	155860627	missense	probably benign	0.06
IGL03268:Cep350	APN	1	155953549	missense	probably benign	0.16
IGL03358:Cep350	APN	1	155928539	missense	probably benign
primed	UTSW	1	155953588	missense	probably damaging	0.98
stoked	UTSW	1	155915575	missense	probably benign	0.03
NA:Cep350	UTSW	1	155958648	missense	probably damaging	1.00
R0060:Cep350	UTSW	1	155928626	missense	probably damaging	1.00
R0060:Cep350	UTSW	1	155928626	missense	probably damaging	1.00
R0066:Cep350	UTSW	1	155911218	missense	probably damaging	0.99
R0066:Cep350	UTSW	1	155911218	missense	probably damaging	0.99
R0172:Cep350	UTSW	1	155953447	missense	probably benign	0.00
R0365:Cep350	UTSW	1	155906571	missense	probably benign	0.00
R0472:Cep350	UTSW	1	155914723	missense	probably damaging	0.99
R0502:Cep350	UTSW	1	155900883	splice site	probably null
R0538:Cep350	UTSW	1	155848620	missense	possibly damaging	0.80
R0547:Cep350	UTSW	1	155901435	splice site	probably null
R0565:Cep350	UTSW	1	155961195	splice site	probably benign
R0607:Cep350	UTSW	1	155872048	missense	probably damaging	1.00
R0645:Cep350	UTSW	1	155940712	splice site	probably null
R0675:Cep350	UTSW	1	155959753	missense	possibly damaging	0.63
R0828:Cep350	UTSW	1	155953246	missense	probably benign	0.00
R0863:Cep350	UTSW	1	155862235	missense	probably benign	0.00
R0969:Cep350	UTSW	1	155940826	missense	possibly damaging	0.81
R1102:Cep350	UTSW	1	155931518	missense	probably damaging	1.00
R1186:Cep350	UTSW	1	155875376	missense	probably damaging	1.00
R1552:Cep350	UTSW	1	155910738	missense	possibly damaging	0.92
R1560:Cep350	UTSW	1	155929079	missense	possibly damaging	0.48
R1698:Cep350	UTSW	1	155953358	missense	possibly damaging	0.62
R1729:Cep350	UTSW	1	155911981	missense	probably benign	0.17
R1735:Cep350	UTSW	1	155953214	missense	probably damaging	0.99
R1740:Cep350	UTSW	1	155928833	missense	probably damaging	1.00
R1783:Cep350	UTSW	1	155928865	missense	probably damaging	1.00
R1844:Cep350	UTSW	1	155848628	missense	probably damaging	0.99
R1848:Cep350	UTSW	1	155953651	missense	probably benign	0.28
R1988:Cep350	UTSW	1	155933104	missense	possibly damaging	0.82
R2008:Cep350	UTSW	1	155914721	missense	probably benign	0.16
R2241:Cep350	UTSW	1	155958556	splice site	probably null
R2245:Cep350	UTSW	1	155879020	missense	probably benign	0.10
R2402:Cep350	UTSW	1	155863136	missense	probably benign
R2566:Cep350	UTSW	1	155959718	critical splice donor site	probably null
R3160:Cep350	UTSW	1	155863164	missense	probably benign	0.00
R3162:Cep350	UTSW	1	155863164	missense	probably benign	0.00
R3769:Cep350	UTSW	1	155953204	missense	probably damaging	1.00
R4035:Cep350	UTSW	1	155959795	missense	probably benign	0.06
R4158:Cep350	UTSW	1	155932875	missense	probably damaging	1.00
R4160:Cep350	UTSW	1	155932875	missense	probably damaging	1.00
R4213:Cep350	UTSW	1	155935961	missense	probably damaging	1.00
R4483:Cep350	UTSW	1	155926468	missense	probably benign	0.01
R4648:Cep350	UTSW	1	155902598	missense	possibly damaging	0.85
R4694:Cep350	UTSW	1	155928586	missense	probably damaging	1.00
R4836:Cep350	UTSW	1	155928833	missense	probably damaging	1.00
R4839:Cep350	UTSW	1	155928494	missense	probably benign	0.00
R4969:Cep350	UTSW	1	155860279	missense	probably damaging	0.99
R5014:Cep350	UTSW	1	155928206	missense	probably benign	0.00
R5027:Cep350	UTSW	1	155933354	missense	probably benign	0.01
R5144:Cep350	UTSW	1	155911150	missense	probably damaging	0.99
R5153:Cep350	UTSW	1	155935946	missense	probably damaging	1.00
R5165:Cep350	UTSW	1	155928368	missense	probably damaging	1.00
R5182:Cep350	UTSW	1	155858108	missense	probably damaging	1.00
R5445:Cep350	UTSW	1	155894723	missense	probably benign	0.01
R5738:Cep350	UTSW	1	155866078	missense	probably damaging	1.00
R5809:Cep350	UTSW	1	155933341	missense	probably damaging	0.98
R5855:Cep350	UTSW	1	155953762	missense	probably benign	0.00
R6103:Cep350	UTSW	1	155924576	missense	probably benign	0.05
R6139:Cep350	UTSW	1	155953279	missense	probably benign	0.03
R6285:Cep350	UTSW	1	155953374	missense	possibly damaging	0.48
R6430:Cep350	UTSW	1	155894673	missense	probably damaging	1.00
R6446:Cep350	UTSW	1	155862154	missense	probably benign
R6520:Cep350	UTSW	1	155933336	missense	probably benign	0.02
R6712:Cep350	UTSW	1	155858106	missense	possibly damaging	0.93
R6940:Cep350	UTSW	1	155928551	missense	probably benign	0.01
R7020:Cep350	UTSW	1	155928331	missense	probably damaging	1.00
R7056:Cep350	UTSW	1	155848627	missense	probably damaging	1.00
R7141:Cep350	UTSW	1	155914748	missense	probably damaging	1.00
R7215:Cep350	UTSW	1	155894707	missense	possibly damaging	0.89
R7247:Cep350	UTSW	1	155910753	missense	probably damaging	1.00
R7272:Cep350	UTSW	1	155953588	missense	probably damaging	0.98
R7336:Cep350	UTSW	1	155862276	missense	probably benign	0.17
R7361:Cep350	UTSW	1	155901491	missense	probably damaging	1.00
R7390:Cep350	UTSW	1	155866087	missense	possibly damaging	0.94
R7402:Cep350	UTSW	1	155928215	missense	probably benign	0.00
R7428:Cep350	UTSW	1	155894619	missense	probably benign	0.00
R7440:Cep350	UTSW	1	155940772	missense	probably damaging	0.98
R7520:Cep350	UTSW	1	155915629	missense	probably benign	0.05
R7529:Cep350	UTSW	1	155861923	missense	probably benign	0.08
R7635:Cep350	UTSW	1	155879021	nonsense	probably null
R7806:Cep350	UTSW	1	155862063	missense	probably benign	0.00
R8100:Cep350	UTSW	1	155953402	missense	probably damaging	0.97
R8193:Cep350	UTSW	1	155862079	missense	probably benign	0.01
R8351:Cep350	UTSW	1	155872034	missense	probably damaging	0.99
R8406:Cep350	UTSW	1	155922418	missense	probably benign	0.00
R8451:Cep350	UTSW	1	155872034	missense	probably damaging	0.99
R8467:Cep350	UTSW	1	155915575	missense	probably benign	0.03
R8543:Cep350	UTSW	1	155862376	missense	probably damaging	0.98
R8714:Cep350	UTSW	1	155860731	missense	probably damaging	0.98
R8810:Cep350	UTSW	1	155928116	missense	probably damaging	1.00
R8837:Cep350	UTSW	1	155861772	missense	probably benign	0.09
R8933:Cep350	UTSW	1	155863415	missense	probably benign	0.01
R9043:Cep350	UTSW	1	155897482	missense	probably damaging	1.00
R9050:Cep350	UTSW	1	155862941	missense	possibly damaging	0.81
R9067:Cep350	UTSW	1	155861739	missense	probably benign	0.00
R9105:Cep350	UTSW	1	155959815	missense	probably damaging	1.00
R9295:Cep350	UTSW	1	155862305	nonsense	probably null
R9304:Cep350	UTSW	1	155953718	missense	probably damaging	0.98
R9456:Cep350	UTSW	1	155868711	missense	probably benign	0.00
R9575:Cep350	UTSW	1	155875367	missense	probably benign	0.03
R9715:Cep350	UTSW	1	155875361	missense	probably benign	0.00
R9749:Cep350	UTSW	1	155953239	missense	probably benign	0.02
R9758:Cep350	UTSW	1	155894687	missense	probably damaging	0.96
R9767:Cep350	UTSW	1	155863272	missense	probably benign	0.01
RF020:Cep350	UTSW	1	155915478	missense	probably benign	0.34
X0018:Cep350	UTSW	1	155953286	missense	probably benign	0.13

Predicted Primers

PCR Primer
(F):5'- ACAGTTAATGCTGTCAACTATACCT -3'
(R):5'- TTGCAGTTGACCTTGGGTAAC -3'

Sequencing Primer
(F):5'- CCTAAGAATGAGAACATCTGG -3'
(R):5'- CCGAAGCTGCAGAAATAGGGTAC -3'

Posted On

2020-07-13