Incidental Mutation 'R8192:Zfp442'
ID 635201
Institutional Source Beutler Lab
Gene Symbol Zfp442
Ensembl Gene ENSMUSG00000068130
Gene Name zinc finger protein 442
Synonyms OTTMUSG00000015730
MMRRC Submission 067615-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.060) question?
Stock # R8192 (G1)
Quality Score 181.009
Status Not validated
Chromosome 2
Chromosomal Location 150249061-150293406 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 150250629 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Methionine at position 424 (I424M)
Ref Sequence ENSEMBL: ENSMUSP00000105542 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109916] [ENSMUST00000185796]
AlphaFold A2AQA0
Predicted Effect unknown
Transcript: ENSMUST00000109916
AA Change: I424M
SMART Domains Protein: ENSMUSP00000105542
Gene: ENSMUSG00000068130
AA Change: I424M

DomainStartEndE-ValueType
KRAB 4 66 3.27e-19 SMART
ZnF_C2H2 159 181 8.34e-3 SMART
ZnF_C2H2 211 233 9.58e-3 SMART
ZnF_C2H2 239 261 2.43e-4 SMART
ZnF_C2H2 267 289 1.38e-3 SMART
ZnF_C2H2 295 317 4.17e-3 SMART
ZnF_C2H2 323 345 3.16e-3 SMART
ZnF_C2H2 351 373 1.58e-3 SMART
ZnF_C2H2 379 401 9.58e-3 SMART
ZnF_C2H2 407 429 2.09e-3 SMART
ZnF_C2H2 435 457 2.2e-2 SMART
ZnF_C2H2 463 485 1.6e-4 SMART
ZnF_C2H2 491 513 1.82e-3 SMART
ZnF_C2H2 519 541 4.47e-3 SMART
ZnF_C2H2 547 569 3.63e-3 SMART
ZnF_C2H2 575 597 4.79e-3 SMART
ZnF_C2H2 603 625 8.47e-4 SMART
ZnF_C2H2 631 654 3.11e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185796
SMART Domains Protein: ENSMUSP00000140098
Gene: ENSMUSG00000068130

DomainStartEndE-ValueType
KRAB 3 65 1.4e-21 SMART
ZnF_C2H2 158 180 3.4e-5 SMART
ZnF_C2H2 210 232 3.9e-5 SMART
ZnF_C2H2 238 260 1e-6 SMART
ZnF_C2H2 266 288 5.6e-6 SMART
ZnF_C2H2 294 316 1.8e-5 SMART
ZnF_C2H2 322 344 1.3e-5 SMART
ZnF_C2H2 350 372 6.7e-6 SMART
ZnF_C2H2 378 400 9.6e-5 SMART
ZnF_C2H2 406 428 6.9e-7 SMART
ZnF_C2H2 434 456 7.7e-6 SMART
ZnF_C2H2 462 484 1.9e-5 SMART
ZnF_C2H2 490 512 1.5e-5 SMART
ZnF_C2H2 518 540 2e-5 SMART
ZnF_C2H2 546 568 3.5e-6 SMART
ZnF_C2H2 574 597 1.3e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 100% (64/64)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 A T 8: 44,103,970 (GRCm39) D558E probably damaging Het
Alox15 T A 11: 70,241,736 (GRCm39) E48D probably benign Het
Alyref T C 11: 120,488,522 (GRCm39) E102G probably benign Het
Bach2 A G 4: 32,562,294 (GRCm39) S254G probably benign Het
Bcl2l13 A G 6: 120,853,267 (GRCm39) E184G possibly damaging Het
Best1 T A 19: 9,963,664 (GRCm39) I506F possibly damaging Het
Cd177 T A 7: 24,453,727 (GRCm39) D388V probably benign Het
Cep350 T C 1: 155,816,529 (GRCm39) K329E possibly damaging Het
Clasrp T C 7: 19,329,387 (GRCm39) N65S possibly damaging Het
Cobl T C 11: 12,199,745 (GRCm39) R1301G probably benign Het
Cul9 T C 17: 46,849,273 (GRCm39) E624G probably benign Het
Cyp21a1 A T 17: 35,022,633 (GRCm39) Y109N probably damaging Het
Dbf4 A G 5: 8,448,134 (GRCm39) S359P probably benign Het
Ddx60 A G 8: 62,431,002 (GRCm39) T846A probably damaging Het
Dnah11 A G 12: 117,976,181 (GRCm39) V2746A probably benign Het
Dnah12 G A 14: 26,428,036 (GRCm39) A221T probably benign Het
Dnajb8 C T 6: 88,199,940 (GRCm39) R159C possibly damaging Het
Dock2 A G 11: 34,623,166 (GRCm39) probably null Het
Dpy19l1 T C 9: 24,362,023 (GRCm39) I119V possibly damaging Het
Dsg1c A G 18: 20,399,255 (GRCm39) T120A probably damaging Het
Dzank1 T C 2: 144,332,145 (GRCm39) H397R probably benign Het
Gaa G T 11: 119,161,235 (GRCm39) A93S possibly damaging Het
Galnt4 G A 10: 98,945,118 (GRCm39) R281H probably benign Het
Gm3250 T C 10: 77,618,291 (GRCm39) E29G unknown Het
H13 T G 2: 152,511,522 (GRCm39) D7E probably benign Het
H60c T A 10: 3,209,781 (GRCm39) I140F probably benign Het
Hsd3b2 T C 3: 98,620,908 (GRCm39) N49S probably benign Het
Klhl11 G T 11: 100,354,922 (GRCm39) P300T probably benign Het
Knop1 C A 7: 118,452,369 (GRCm39) V117L Het
Lgalsl2 T A 7: 5,362,595 (GRCm39) D75E possibly damaging Het
Lrrc38 G A 4: 143,077,303 (GRCm39) G189R probably damaging Het
Lrrc9 A T 12: 72,496,163 (GRCm39) I13F probably damaging Het
Macf1 A G 4: 123,334,390 (GRCm39) S4456P probably damaging Het
Mkrn1 A T 6: 39,376,289 (GRCm39) V439D probably damaging Het
Muc2 T A 7: 141,305,215 (GRCm39) V612D Het
Nrxn3 A G 12: 90,171,569 (GRCm39) N967D probably benign Het
Oprm1 C T 10: 6,788,417 (GRCm39) P391S probably benign Het
Or10g7 T A 9: 39,905,467 (GRCm39) D120E probably damaging Het
Or5d43 A C 2: 88,105,288 (GRCm39) V35G probably damaging Het
Parp14 T A 16: 35,691,584 (GRCm39) E47V probably benign Het
Pikfyve A G 1: 65,285,554 (GRCm39) E931G possibly damaging Het
Plcz1 A T 6: 139,968,986 (GRCm39) C151S probably damaging Het
Pramel20 T G 4: 143,298,530 (GRCm39) Y158D probably benign Het
Pramel27 G A 4: 143,578,109 (GRCm39) W123* probably null Het
Rbm26 A G 14: 105,380,125 (GRCm39) probably null Het
Rffl G T 11: 82,703,549 (GRCm39) probably null Het
Sc5d T C 9: 42,171,094 (GRCm39) I32V probably benign Het
Scube1 A G 15: 83,513,583 (GRCm39) probably null Het
Shld2 A T 14: 33,967,173 (GRCm39) S680T probably benign Het
Slc12a6 A G 2: 112,181,722 (GRCm39) Y714C probably damaging Het
Slc26a3 A G 12: 31,518,541 (GRCm39) I670V probably benign Het
Slc8a3 A T 12: 81,246,455 (GRCm39) V866D probably damaging Het
Slco3a1 A T 7: 73,970,338 (GRCm39) M423K probably benign Het
Smc6 A G 12: 11,349,336 (GRCm39) E773G probably benign Het
Son A G 16: 91,452,437 (GRCm39) T395A possibly damaging Het
Ss18l1 T C 2: 179,701,155 (GRCm39) S290P probably damaging Het
Tcof1 A C 18: 60,976,375 (GRCm39) V78G probably damaging Het
Thsd1 G A 8: 22,733,918 (GRCm39) V322M probably benign Het
Tln2 A T 9: 67,253,811 (GRCm39) C753* probably null Het
Trav6n-6 T A 14: 53,370,497 (GRCm39) F83I probably damaging Het
Ttc39d A G 17: 80,524,007 (GRCm39) H222R probably damaging Het
Ugt2b35 T A 5: 87,149,302 (GRCm39) S184R probably damaging Het
Upf1 A G 8: 70,793,294 (GRCm39) L288P probably benign Het
Zfp580 T C 7: 5,056,114 (GRCm39) V100A probably benign Het
Zfpm1 C A 8: 123,058,833 (GRCm39) P151Q probably damaging Het
Zfr2 C T 10: 81,078,649 (GRCm39) P294S possibly damaging Het
Other mutations in Zfp442
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01081:Zfp442 APN 2 150,251,267 (GRCm39) nonsense probably null
IGL02566:Zfp442 APN 2 150,251,711 (GRCm39) critical splice acceptor site probably null
IGL03217:Zfp442 APN 2 150,251,714 (GRCm39) splice site probably benign
LCD18:Zfp442 UTSW 2 150,261,768 (GRCm39) intron probably benign
PIT4812001:Zfp442 UTSW 2 150,251,661 (GRCm39) nonsense probably null
R0219:Zfp442 UTSW 2 150,253,160 (GRCm39) missense probably damaging 0.99
R0521:Zfp442 UTSW 2 150,253,169 (GRCm39) missense possibly damaging 0.92
R1633:Zfp442 UTSW 2 150,250,260 (GRCm39) nonsense probably null
R1702:Zfp442 UTSW 2 150,251,100 (GRCm39) nonsense probably null
R1829:Zfp442 UTSW 2 150,250,983 (GRCm39) missense probably damaging 0.99
R1868:Zfp442 UTSW 2 150,250,100 (GRCm39) missense probably damaging 1.00
R1898:Zfp442 UTSW 2 150,250,582 (GRCm39) missense probably damaging 1.00
R2030:Zfp442 UTSW 2 150,250,042 (GRCm39) missense possibly damaging 0.58
R4676:Zfp442 UTSW 2 150,251,526 (GRCm39) missense probably damaging 1.00
R4717:Zfp442 UTSW 2 150,250,149 (GRCm39) missense probably damaging 1.00
R4894:Zfp442 UTSW 2 150,253,130 (GRCm39) critical splice donor site probably null
R4932:Zfp442 UTSW 2 150,251,635 (GRCm39) missense possibly damaging 0.53
R4963:Zfp442 UTSW 2 150,250,415 (GRCm39) missense probably damaging 1.00
R5130:Zfp442 UTSW 2 150,251,530 (GRCm39) missense possibly damaging 0.91
R5476:Zfp442 UTSW 2 150,250,079 (GRCm39) missense probably damaging 1.00
R5986:Zfp442 UTSW 2 150,249,944 (GRCm39) nonsense probably null
R6042:Zfp442 UTSW 2 150,250,016 (GRCm39) missense probably damaging 0.97
R6383:Zfp442 UTSW 2 150,293,321 (GRCm39) critical splice donor site probably null
R6452:Zfp442 UTSW 2 150,250,028 (GRCm39) missense probably damaging 1.00
R6787:Zfp442 UTSW 2 150,251,499 (GRCm39) missense possibly damaging 0.72
R6931:Zfp442 UTSW 2 150,252,860 (GRCm39) critical splice donor site probably null
R7061:Zfp442 UTSW 2 150,249,937 (GRCm39) missense probably benign 0.33
R7184:Zfp442 UTSW 2 150,250,056 (GRCm39) missense possibly damaging 0.71
R7214:Zfp442 UTSW 2 150,251,201 (GRCm39) missense probably benign 0.04
R7225:Zfp442 UTSW 2 150,250,925 (GRCm39) missense probably benign 0.00
R7513:Zfp442 UTSW 2 150,250,676 (GRCm39) missense unknown
R7591:Zfp442 UTSW 2 150,250,092 (GRCm39) nonsense probably null
R7679:Zfp442 UTSW 2 150,252,917 (GRCm39) nonsense probably null
R7768:Zfp442 UTSW 2 150,250,241 (GRCm39) missense possibly damaging 0.53
R7801:Zfp442 UTSW 2 150,251,639 (GRCm39) missense probably benign 0.28
R7814:Zfp442 UTSW 2 150,251,402 (GRCm39) missense possibly damaging 0.92
R7848:Zfp442 UTSW 2 150,253,146 (GRCm39) missense possibly damaging 0.71
R8158:Zfp442 UTSW 2 150,251,096 (GRCm39) missense possibly damaging 0.83
R8528:Zfp442 UTSW 2 150,250,962 (GRCm39) missense probably damaging 1.00
R9110:Zfp442 UTSW 2 150,250,093 (GRCm39) missense probably benign 0.30
R9269:Zfp442 UTSW 2 150,251,287 (GRCm39) missense probably benign 0.19
R9371:Zfp442 UTSW 2 150,250,676 (GRCm39) missense unknown
R9401:Zfp442 UTSW 2 150,251,615 (GRCm39) missense possibly damaging 0.53
R9459:Zfp442 UTSW 2 150,250,668 (GRCm39) missense unknown
R9711:Zfp442 UTSW 2 150,250,207 (GRCm39) missense possibly damaging 0.93
Z1177:Zfp442 UTSW 2 150,250,399 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TAGCTTGACATGCAAATGCCTTAT -3'
(R):5'- CTCTTCGCTGTCATCTTCGAAGG -3'

Sequencing Primer
(F):5'- TACCACACTGCTTACATTCATAGGG -3'
(R):5'- GCTGTCATCTTCGAAGGCATCAAAG -3'
Posted On 2020-07-13