Incidental Mutation 'R8192:Zfp442'
ID635201
Institutional Source Beutler Lab
Gene Symbol Zfp442
Ensembl Gene ENSMUSG00000068130
Gene Namezinc finger protein 442
SynonymsOTTMUSG00000015730
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R8192 (G1)
Quality Score181.009
Status Not validated
Chromosome2
Chromosomal Location150407141-150451486 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 150408709 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 424 (I424M)
Ref Sequence ENSEMBL: ENSMUSP00000105542 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109916] [ENSMUST00000185796]
Predicted Effect unknown
Transcript: ENSMUST00000109916
AA Change: I424M
SMART Domains Protein: ENSMUSP00000105542
Gene: ENSMUSG00000068130
AA Change: I424M

DomainStartEndE-ValueType
KRAB 4 66 3.27e-19 SMART
ZnF_C2H2 159 181 8.34e-3 SMART
ZnF_C2H2 211 233 9.58e-3 SMART
ZnF_C2H2 239 261 2.43e-4 SMART
ZnF_C2H2 267 289 1.38e-3 SMART
ZnF_C2H2 295 317 4.17e-3 SMART
ZnF_C2H2 323 345 3.16e-3 SMART
ZnF_C2H2 351 373 1.58e-3 SMART
ZnF_C2H2 379 401 9.58e-3 SMART
ZnF_C2H2 407 429 2.09e-3 SMART
ZnF_C2H2 435 457 2.2e-2 SMART
ZnF_C2H2 463 485 1.6e-4 SMART
ZnF_C2H2 491 513 1.82e-3 SMART
ZnF_C2H2 519 541 4.47e-3 SMART
ZnF_C2H2 547 569 3.63e-3 SMART
ZnF_C2H2 575 597 4.79e-3 SMART
ZnF_C2H2 603 625 8.47e-4 SMART
ZnF_C2H2 631 654 3.11e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185796
SMART Domains Protein: ENSMUSP00000140098
Gene: ENSMUSG00000068130

DomainStartEndE-ValueType
KRAB 3 65 1.4e-21 SMART
ZnF_C2H2 158 180 3.4e-5 SMART
ZnF_C2H2 210 232 3.9e-5 SMART
ZnF_C2H2 238 260 1e-6 SMART
ZnF_C2H2 266 288 5.6e-6 SMART
ZnF_C2H2 294 316 1.8e-5 SMART
ZnF_C2H2 322 344 1.3e-5 SMART
ZnF_C2H2 350 372 6.7e-6 SMART
ZnF_C2H2 378 400 9.6e-5 SMART
ZnF_C2H2 406 428 6.9e-7 SMART
ZnF_C2H2 434 456 7.7e-6 SMART
ZnF_C2H2 462 484 1.9e-5 SMART
ZnF_C2H2 490 512 1.5e-5 SMART
ZnF_C2H2 518 540 2e-5 SMART
ZnF_C2H2 546 568 3.5e-6 SMART
ZnF_C2H2 574 597 1.3e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 100% (64/64)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 A T 8: 43,650,933 D558E probably damaging Het
Alox15 T A 11: 70,350,910 E48D probably benign Het
Alyref T C 11: 120,597,696 E102G probably benign Het
Bach2 A G 4: 32,562,294 S254G probably benign Het
BC080695 T G 4: 143,571,960 Y158D probably benign Het
Bcl2l13 A G 6: 120,876,306 E184G possibly damaging Het
Best1 T A 19: 9,986,300 I506F possibly damaging Het
Cd177 T A 7: 24,754,302 D388V probably benign Het
Cep350 T C 1: 155,940,783 K329E possibly damaging Het
Clasrp T C 7: 19,595,462 N65S possibly damaging Het
Cobl T C 11: 12,249,745 R1301G probably benign Het
Cul9 T C 17: 46,538,347 E624G probably benign Het
Cyp21a1 A T 17: 34,803,659 Y109N probably damaging Het
Dbf4 A G 5: 8,398,134 S359P probably benign Het
Ddx60 A G 8: 61,977,968 T846A probably damaging Het
Dnah11 A G 12: 118,012,446 V2746A probably benign Het
Dnah12 G A 14: 26,706,881 A221T probably benign Het
Dnajb8 C T 6: 88,222,958 R159C possibly damaging Het
Dock2 A G 11: 34,732,339 probably null Het
Dpy19l1 T C 9: 24,450,727 I119V possibly damaging Het
Dsg1c A G 18: 20,266,198 T120A probably damaging Het
Dzank1 T C 2: 144,490,225 H397R probably benign Het
Fam35a A T 14: 34,245,216 S680T probably benign Het
Gaa G T 11: 119,270,409 A93S possibly damaging Het
Galnt4 G A 10: 99,109,256 R281H probably benign Het
Gm13103 G A 4: 143,851,539 W123* probably null Het
Gm3250 T C 10: 77,782,457 E29G unknown Het
Gm5065 T A 7: 5,359,596 D75E possibly damaging Het
H13 T G 2: 152,669,602 D7E probably benign Het
H60c T A 10: 3,259,781 I140F probably benign Het
Hsd3b2 T C 3: 98,713,592 N49S probably benign Het
Klhl11 G T 11: 100,464,096 P300T probably benign Het
Knop1 C A 7: 118,853,146 V117L Het
Lrrc38 G A 4: 143,350,733 G189R probably damaging Het
Lrrc9 A T 12: 72,449,389 I13F probably damaging Het
Macf1 A G 4: 123,440,597 S4456P probably damaging Het
Mkrn1 A T 6: 39,399,355 V439D probably damaging Het
Muc2 T A 7: 141,751,478 V612D Het
Nrxn3 A G 12: 90,204,795 N967D probably benign Het
Olfr1173 A C 2: 88,274,944 V35G probably damaging Het
Olfr978 T A 9: 39,994,171 D120E probably damaging Het
Oprm1 C T 10: 6,838,417 P391S probably benign Het
Parp14 T A 16: 35,871,214 E47V probably benign Het
Pikfyve A G 1: 65,246,395 E931G possibly damaging Het
Plcz1 A T 6: 140,023,260 C151S probably damaging Het
Rbm26 A G 14: 105,142,689 probably null Het
Rffl G T 11: 82,812,723 probably null Het
Sc5d T C 9: 42,259,798 I32V probably benign Het
Scube1 A G 15: 83,629,382 probably null Het
Slc12a6 A G 2: 112,351,377 Y714C probably damaging Het
Slc26a3 A G 12: 31,468,542 I670V probably benign Het
Slc8a3 A T 12: 81,199,681 V866D probably damaging Het
Slco3a1 A T 7: 74,320,590 M423K probably benign Het
Smc6 A G 12: 11,299,335 E773G probably benign Het
Son A G 16: 91,655,549 T395A possibly damaging Het
Ss18l1 T C 2: 180,059,362 S290P probably damaging Het
Tcof1 A C 18: 60,843,303 V78G probably damaging Het
Thsd1 G A 8: 22,243,902 V322M probably benign Het
Tln2 A T 9: 67,346,529 C753* probably null Het
Trav6n-6 T A 14: 53,133,040 F83I probably damaging Het
Ttc39d A G 17: 80,216,578 H222R probably damaging Het
Ugt2b35 T A 5: 87,001,443 S184R probably damaging Het
Upf1 A G 8: 70,340,644 L288P probably benign Het
Zfp580 T C 7: 5,053,115 V100A probably benign Het
Zfpm1 C A 8: 122,332,094 P151Q probably damaging Het
Zfr2 C T 10: 81,242,815 P294S possibly damaging Het
Other mutations in Zfp442
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01081:Zfp442 APN 2 150409347 nonsense probably null
IGL02566:Zfp442 APN 2 150409791 critical splice acceptor site probably null
IGL03217:Zfp442 APN 2 150409794 splice site probably benign
LCD18:Zfp442 UTSW 2 150419848 intron probably benign
PIT4812001:Zfp442 UTSW 2 150409741 nonsense probably null
R0219:Zfp442 UTSW 2 150411240 missense probably damaging 0.99
R0521:Zfp442 UTSW 2 150411249 missense possibly damaging 0.92
R1633:Zfp442 UTSW 2 150408340 nonsense probably null
R1702:Zfp442 UTSW 2 150409180 nonsense probably null
R1829:Zfp442 UTSW 2 150409063 missense probably damaging 0.99
R1868:Zfp442 UTSW 2 150408180 missense probably damaging 1.00
R1898:Zfp442 UTSW 2 150408662 missense probably damaging 1.00
R2030:Zfp442 UTSW 2 150408122 missense possibly damaging 0.58
R4676:Zfp442 UTSW 2 150409606 missense probably damaging 1.00
R4717:Zfp442 UTSW 2 150408229 missense probably damaging 1.00
R4894:Zfp442 UTSW 2 150411210 critical splice donor site probably null
R4932:Zfp442 UTSW 2 150409715 missense possibly damaging 0.53
R4963:Zfp442 UTSW 2 150408495 missense probably damaging 1.00
R5130:Zfp442 UTSW 2 150409610 missense possibly damaging 0.91
R5476:Zfp442 UTSW 2 150408159 missense probably damaging 1.00
R5986:Zfp442 UTSW 2 150408024 nonsense probably null
R6042:Zfp442 UTSW 2 150408096 missense probably damaging 0.97
R6383:Zfp442 UTSW 2 150451401 critical splice donor site probably null
R6452:Zfp442 UTSW 2 150408108 missense probably damaging 1.00
R6787:Zfp442 UTSW 2 150409579 missense possibly damaging 0.72
R6931:Zfp442 UTSW 2 150410940 critical splice donor site probably null
R7061:Zfp442 UTSW 2 150408017 missense probably benign 0.33
R7184:Zfp442 UTSW 2 150408136 missense possibly damaging 0.71
R7214:Zfp442 UTSW 2 150409281 missense probably benign 0.04
R7225:Zfp442 UTSW 2 150409005 missense probably benign 0.00
R7513:Zfp442 UTSW 2 150408756 missense unknown
R7591:Zfp442 UTSW 2 150408172 nonsense probably null
R7679:Zfp442 UTSW 2 150410997 nonsense probably null
R7768:Zfp442 UTSW 2 150408321 missense possibly damaging 0.53
R7801:Zfp442 UTSW 2 150409719 missense probably benign 0.28
R7814:Zfp442 UTSW 2 150409482 missense possibly damaging 0.92
R7848:Zfp442 UTSW 2 150411226 missense possibly damaging 0.71
R8158:Zfp442 UTSW 2 150409176 missense possibly damaging 0.83
Z1177:Zfp442 UTSW 2 150408479 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TAGCTTGACATGCAAATGCCTTAT -3'
(R):5'- CTCTTCGCTGTCATCTTCGAAGG -3'

Sequencing Primer
(F):5'- TACCACACTGCTTACATTCATAGGG -3'
(R):5'- GCTGTCATCTTCGAAGGCATCAAAG -3'
Posted On2020-07-13