Incidental Mutation 'R8192:Lrrc38'
ID 635207
Institutional Source Beutler Lab
Gene Symbol Lrrc38
Ensembl Gene ENSMUSG00000028584
Gene Name leucine rich repeat containing 38
Synonyms A230053A07Rik
MMRRC Submission 067615-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.056) question?
Stock # R8192 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 143076327-143097602 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 143077303 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Arginine at position 189 (G189R)
Ref Sequence ENSEMBL: ENSMUSP00000053597 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052458]
AlphaFold A2VDH3
Predicted Effect probably damaging
Transcript: ENSMUST00000052458
AA Change: G189R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000053597
Gene: ENSMUSG00000028584
AA Change: G189R

DomainStartEndE-ValueType
low complexity region 12 27 N/A INTRINSIC
LRRNT 31 64 2.82e-4 SMART
LRR 84 106 1.37e1 SMART
LRR 108 130 5.26e0 SMART
LRR 132 154 2.27e1 SMART
LRR 155 178 8.09e-1 SMART
LRRCT 190 244 8.63e-6 SMART
transmembrane domain 252 274 N/A INTRINSIC
low complexity region 288 298 N/A INTRINSIC
Meta Mutation Damage Score 0.1238 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 100% (64/64)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 A T 8: 44,103,970 (GRCm39) D558E probably damaging Het
Alox15 T A 11: 70,241,736 (GRCm39) E48D probably benign Het
Alyref T C 11: 120,488,522 (GRCm39) E102G probably benign Het
Bach2 A G 4: 32,562,294 (GRCm39) S254G probably benign Het
Bcl2l13 A G 6: 120,853,267 (GRCm39) E184G possibly damaging Het
Best1 T A 19: 9,963,664 (GRCm39) I506F possibly damaging Het
Cd177 T A 7: 24,453,727 (GRCm39) D388V probably benign Het
Cep350 T C 1: 155,816,529 (GRCm39) K329E possibly damaging Het
Clasrp T C 7: 19,329,387 (GRCm39) N65S possibly damaging Het
Cobl T C 11: 12,199,745 (GRCm39) R1301G probably benign Het
Cul9 T C 17: 46,849,273 (GRCm39) E624G probably benign Het
Cyp21a1 A T 17: 35,022,633 (GRCm39) Y109N probably damaging Het
Dbf4 A G 5: 8,448,134 (GRCm39) S359P probably benign Het
Ddx60 A G 8: 62,431,002 (GRCm39) T846A probably damaging Het
Dnah11 A G 12: 117,976,181 (GRCm39) V2746A probably benign Het
Dnah12 G A 14: 26,428,036 (GRCm39) A221T probably benign Het
Dnajb8 C T 6: 88,199,940 (GRCm39) R159C possibly damaging Het
Dock2 A G 11: 34,623,166 (GRCm39) probably null Het
Dpy19l1 T C 9: 24,362,023 (GRCm39) I119V possibly damaging Het
Dsg1c A G 18: 20,399,255 (GRCm39) T120A probably damaging Het
Dzank1 T C 2: 144,332,145 (GRCm39) H397R probably benign Het
Gaa G T 11: 119,161,235 (GRCm39) A93S possibly damaging Het
Galnt4 G A 10: 98,945,118 (GRCm39) R281H probably benign Het
Gm3250 T C 10: 77,618,291 (GRCm39) E29G unknown Het
H13 T G 2: 152,511,522 (GRCm39) D7E probably benign Het
H60c T A 10: 3,209,781 (GRCm39) I140F probably benign Het
Hsd3b2 T C 3: 98,620,908 (GRCm39) N49S probably benign Het
Klhl11 G T 11: 100,354,922 (GRCm39) P300T probably benign Het
Knop1 C A 7: 118,452,369 (GRCm39) V117L Het
Lgalsl2 T A 7: 5,362,595 (GRCm39) D75E possibly damaging Het
Lrrc9 A T 12: 72,496,163 (GRCm39) I13F probably damaging Het
Macf1 A G 4: 123,334,390 (GRCm39) S4456P probably damaging Het
Mkrn1 A T 6: 39,376,289 (GRCm39) V439D probably damaging Het
Muc2 T A 7: 141,305,215 (GRCm39) V612D Het
Nrxn3 A G 12: 90,171,569 (GRCm39) N967D probably benign Het
Oprm1 C T 10: 6,788,417 (GRCm39) P391S probably benign Het
Or10g7 T A 9: 39,905,467 (GRCm39) D120E probably damaging Het
Or5d43 A C 2: 88,105,288 (GRCm39) V35G probably damaging Het
Parp14 T A 16: 35,691,584 (GRCm39) E47V probably benign Het
Pikfyve A G 1: 65,285,554 (GRCm39) E931G possibly damaging Het
Plcz1 A T 6: 139,968,986 (GRCm39) C151S probably damaging Het
Pramel20 T G 4: 143,298,530 (GRCm39) Y158D probably benign Het
Pramel27 G A 4: 143,578,109 (GRCm39) W123* probably null Het
Rbm26 A G 14: 105,380,125 (GRCm39) probably null Het
Rffl G T 11: 82,703,549 (GRCm39) probably null Het
Sc5d T C 9: 42,171,094 (GRCm39) I32V probably benign Het
Scube1 A G 15: 83,513,583 (GRCm39) probably null Het
Shld2 A T 14: 33,967,173 (GRCm39) S680T probably benign Het
Slc12a6 A G 2: 112,181,722 (GRCm39) Y714C probably damaging Het
Slc26a3 A G 12: 31,518,541 (GRCm39) I670V probably benign Het
Slc8a3 A T 12: 81,246,455 (GRCm39) V866D probably damaging Het
Slco3a1 A T 7: 73,970,338 (GRCm39) M423K probably benign Het
Smc6 A G 12: 11,349,336 (GRCm39) E773G probably benign Het
Son A G 16: 91,452,437 (GRCm39) T395A possibly damaging Het
Ss18l1 T C 2: 179,701,155 (GRCm39) S290P probably damaging Het
Tcof1 A C 18: 60,976,375 (GRCm39) V78G probably damaging Het
Thsd1 G A 8: 22,733,918 (GRCm39) V322M probably benign Het
Tln2 A T 9: 67,253,811 (GRCm39) C753* probably null Het
Trav6n-6 T A 14: 53,370,497 (GRCm39) F83I probably damaging Het
Ttc39d A G 17: 80,524,007 (GRCm39) H222R probably damaging Het
Ugt2b35 T A 5: 87,149,302 (GRCm39) S184R probably damaging Het
Upf1 A G 8: 70,793,294 (GRCm39) L288P probably benign Het
Zfp442 T C 2: 150,250,629 (GRCm39) I424M unknown Het
Zfp580 T C 7: 5,056,114 (GRCm39) V100A probably benign Het
Zfpm1 C A 8: 123,058,833 (GRCm39) P151Q probably damaging Het
Zfr2 C T 10: 81,078,649 (GRCm39) P294S possibly damaging Het
Other mutations in Lrrc38
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0281:Lrrc38 UTSW 4 143,076,979 (GRCm39) missense probably damaging 0.99
R0545:Lrrc38 UTSW 4 143,077,328 (GRCm39) missense probably benign 0.41
R1078:Lrrc38 UTSW 4 143,077,088 (GRCm39) missense probably benign 0.06
R1467:Lrrc38 UTSW 4 143,096,450 (GRCm39) missense probably damaging 1.00
R1467:Lrrc38 UTSW 4 143,096,450 (GRCm39) missense probably damaging 1.00
R1967:Lrrc38 UTSW 4 143,096,553 (GRCm39) missense unknown
R2221:Lrrc38 UTSW 4 143,096,419 (GRCm39) nonsense probably null
R2223:Lrrc38 UTSW 4 143,096,419 (GRCm39) nonsense probably null
R4061:Lrrc38 UTSW 4 143,077,076 (GRCm39) missense probably damaging 1.00
R4930:Lrrc38 UTSW 4 143,096,438 (GRCm39) missense probably damaging 0.98
R5585:Lrrc38 UTSW 4 143,076,961 (GRCm39) missense probably damaging 0.96
R6787:Lrrc38 UTSW 4 143,096,364 (GRCm39) missense probably benign 0.18
R7046:Lrrc38 UTSW 4 143,076,739 (GRCm39) start codon destroyed probably null
R7706:Lrrc38 UTSW 4 143,076,845 (GRCm39) missense probably damaging 1.00
R8189:Lrrc38 UTSW 4 143,077,303 (GRCm39) missense probably damaging 1.00
R8190:Lrrc38 UTSW 4 143,077,303 (GRCm39) missense probably damaging 1.00
R8219:Lrrc38 UTSW 4 143,077,303 (GRCm39) missense probably damaging 1.00
R8221:Lrrc38 UTSW 4 143,077,303 (GRCm39) missense probably damaging 1.00
R8223:Lrrc38 UTSW 4 143,077,303 (GRCm39) missense probably damaging 1.00
R8226:Lrrc38 UTSW 4 143,077,303 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGGACCTGAGCTACAACAAC -3'
(R):5'- TTCTGGTGAGCCCCAAAACG -3'

Sequencing Primer
(F):5'- CAACCTCACCCAGCTGG -3'
(R):5'- GAGGCCTCACACATCCTG -3'
Posted On 2020-07-13