Incidental Mutation 'R8192:Ddx60'
ID 635225
Institutional Source Beutler Lab
Gene Symbol Ddx60
Ensembl Gene ENSMUSG00000037921
Gene Name DEAD (Asp-Glu-Ala-Asp) box polypeptide 60
Synonyms
MMRRC Submission 067615-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.145) question?
Stock # R8192 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 61928087-62038244 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 61977968 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 846 (T846A)
Ref Sequence ENSEMBL: ENSMUSP00000091197 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070631] [ENSMUST00000093485]
AlphaFold E9PZQ1
Predicted Effect probably damaging
Transcript: ENSMUST00000070631
AA Change: T845A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000070741
Gene: ENSMUSG00000037921
AA Change: T845A

DomainStartEndE-ValueType
low complexity region 99 110 N/A INTRINSIC
low complexity region 364 376 N/A INTRINSIC
DEXDc 758 949 1.05e-15 SMART
Blast:DEXDc 1007 1132 4e-24 BLAST
HELICc 1245 1328 4.35e-13 SMART
low complexity region 1362 1373 N/A INTRINSIC
Blast:DEXDc 1503 1584 1e-20 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000093485
AA Change: T846A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000091197
Gene: ENSMUSG00000037921
AA Change: T846A

DomainStartEndE-ValueType
low complexity region 99 110 N/A INTRINSIC
low complexity region 364 376 N/A INTRINSIC
DEXDc 759 950 1.05e-15 SMART
Blast:DEXDc 1008 1133 4e-24 BLAST
HELICc 1246 1329 4.35e-13 SMART
low complexity region 1363 1374 N/A INTRINSIC
Blast:DEXDc 1504 1585 1e-20 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 100% (64/64)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal immunity to several viruses (IAV, EMCV, SINV) but increased susceptibility to VSV infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 A T 8: 43,650,933 (GRCm38) D558E probably damaging Het
Alox15 T A 11: 70,350,910 (GRCm38) E48D probably benign Het
Alyref T C 11: 120,597,696 (GRCm38) E102G probably benign Het
Bach2 A G 4: 32,562,294 (GRCm38) S254G probably benign Het
Bcl2l13 A G 6: 120,876,306 (GRCm38) E184G possibly damaging Het
Best1 T A 19: 9,986,300 (GRCm38) I506F possibly damaging Het
Cd177 T A 7: 24,754,302 (GRCm38) D388V probably benign Het
Cep350 T C 1: 155,940,783 (GRCm38) K329E possibly damaging Het
Clasrp T C 7: 19,595,462 (GRCm38) N65S possibly damaging Het
Cobl T C 11: 12,249,745 (GRCm38) R1301G probably benign Het
Cul9 T C 17: 46,538,347 (GRCm38) E624G probably benign Het
Cyp21a1 A T 17: 34,803,659 (GRCm38) Y109N probably damaging Het
Dbf4 A G 5: 8,398,134 (GRCm38) S359P probably benign Het
Dnah11 A G 12: 118,012,446 (GRCm38) V2746A probably benign Het
Dnah12 G A 14: 26,706,881 (GRCm38) A221T probably benign Het
Dnajb8 C T 6: 88,222,958 (GRCm38) R159C possibly damaging Het
Dock2 A G 11: 34,732,339 (GRCm38) probably null Het
Dpy19l1 T C 9: 24,450,727 (GRCm38) I119V possibly damaging Het
Dsg1c A G 18: 20,266,198 (GRCm38) T120A probably damaging Het
Dzank1 T C 2: 144,490,225 (GRCm38) H397R probably benign Het
Gaa G T 11: 119,270,409 (GRCm38) A93S possibly damaging Het
Galnt4 G A 10: 99,109,256 (GRCm38) R281H probably benign Het
Gm3250 T C 10: 77,782,457 (GRCm38) E29G unknown Het
H13 T G 2: 152,669,602 (GRCm38) D7E probably benign Het
H60c T A 10: 3,259,781 (GRCm38) I140F probably benign Het
Hsd3b2 T C 3: 98,713,592 (GRCm38) N49S probably benign Het
Klhl11 G T 11: 100,464,096 (GRCm38) P300T probably benign Het
Knop1 C A 7: 118,853,146 (GRCm38) V117L Het
Lgalsl2 T A 7: 5,359,596 (GRCm38) D75E possibly damaging Het
Lrrc38 G A 4: 143,350,733 (GRCm38) G189R probably damaging Het
Lrrc9 A T 12: 72,449,389 (GRCm38) I13F probably damaging Het
Macf1 A G 4: 123,440,597 (GRCm38) S4456P probably damaging Het
Mkrn1 A T 6: 39,399,355 (GRCm38) V439D probably damaging Het
Muc2 T A 7: 141,751,478 (GRCm38) V612D Het
Nrxn3 A G 12: 90,204,795 (GRCm38) N967D probably benign Het
Oprm1 C T 10: 6,838,417 (GRCm38) P391S probably benign Het
Or10g7 T A 9: 39,994,171 (GRCm38) D120E probably damaging Het
Or5d43 A C 2: 88,274,944 (GRCm38) V35G probably damaging Het
Parp14 T A 16: 35,871,214 (GRCm38) E47V probably benign Het
Pikfyve A G 1: 65,246,395 (GRCm38) E931G possibly damaging Het
Plcz1 A T 6: 140,023,260 (GRCm38) C151S probably damaging Het
Pramel20 T G 4: 143,571,960 (GRCm38) Y158D probably benign Het
Pramel27 G A 4: 143,851,539 (GRCm38) W123* probably null Het
Rbm26 A G 14: 105,142,689 (GRCm38) probably null Het
Rffl G T 11: 82,812,723 (GRCm38) probably null Het
Sc5d T C 9: 42,259,798 (GRCm38) I32V probably benign Het
Scube1 A G 15: 83,629,382 (GRCm38) probably null Het
Shld2 A T 14: 34,245,216 (GRCm38) S680T probably benign Het
Slc12a6 A G 2: 112,351,377 (GRCm38) Y714C probably damaging Het
Slc26a3 A G 12: 31,468,542 (GRCm38) I670V probably benign Het
Slc8a3 A T 12: 81,199,681 (GRCm38) V866D probably damaging Het
Slco3a1 A T 7: 74,320,590 (GRCm38) M423K probably benign Het
Smc6 A G 12: 11,299,335 (GRCm38) E773G probably benign Het
Son A G 16: 91,655,549 (GRCm38) T395A possibly damaging Het
Ss18l1 T C 2: 180,059,362 (GRCm38) S290P probably damaging Het
Tcof1 A C 18: 60,843,303 (GRCm38) V78G probably damaging Het
Thsd1 G A 8: 22,243,902 (GRCm38) V322M probably benign Het
Tln2 A T 9: 67,346,529 (GRCm38) C753* probably null Het
Trav6n-6 T A 14: 53,133,040 (GRCm38) F83I probably damaging Het
Ttc39d A G 17: 80,216,578 (GRCm38) H222R probably damaging Het
Ugt2b35 T A 5: 87,001,443 (GRCm38) S184R probably damaging Het
Upf1 A G 8: 70,340,644 (GRCm38) L288P probably benign Het
Zfp442 T C 2: 150,408,709 (GRCm38) I424M unknown Het
Zfp580 T C 7: 5,053,115 (GRCm38) V100A probably benign Het
Zfpm1 C A 8: 122,332,094 (GRCm38) P151Q probably damaging Het
Zfr2 C T 10: 81,242,815 (GRCm38) P294S possibly damaging Het
Other mutations in Ddx60
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Ddx60 APN 8 61,958,646 (GRCm38) missense probably damaging 1.00
IGL00915:Ddx60 APN 8 61,987,431 (GRCm38) missense possibly damaging 0.79
IGL00931:Ddx60 APN 8 61,969,583 (GRCm38) missense probably benign 0.18
IGL01023:Ddx60 APN 8 61,942,514 (GRCm38) missense probably damaging 0.99
IGL01313:Ddx60 APN 8 61,982,526 (GRCm38) missense probably damaging 1.00
IGL01615:Ddx60 APN 8 61,963,740 (GRCm38) missense probably null 0.81
IGL01733:Ddx60 APN 8 61,983,865 (GRCm38) missense probably damaging 0.99
IGL01779:Ddx60 APN 8 62,017,823 (GRCm38) missense possibly damaging 0.94
IGL01900:Ddx60 APN 8 62,000,709 (GRCm38) splice site probably benign
IGL02110:Ddx60 APN 8 62,017,247 (GRCm38) critical splice donor site probably null
IGL02302:Ddx60 APN 8 61,975,832 (GRCm38) missense possibly damaging 0.85
IGL02468:Ddx60 APN 8 61,958,642 (GRCm38) missense probably damaging 1.00
IGL02569:Ddx60 APN 8 62,024,951 (GRCm38) missense possibly damaging 0.93
IGL02622:Ddx60 APN 8 61,942,436 (GRCm38) splice site probably null
IGL02657:Ddx60 APN 8 61,984,115 (GRCm38) missense probably benign 0.01
IGL02677:Ddx60 APN 8 61,988,132 (GRCm38) missense probably damaging 1.00
IGL02701:Ddx60 APN 8 61,979,341 (GRCm38) missense probably damaging 0.96
IGL02806:Ddx60 APN 8 61,956,122 (GRCm38) missense probably benign 0.00
IGL03137:Ddx60 APN 8 61,988,083 (GRCm38) missense possibly damaging 0.61
IGL03295:Ddx60 APN 8 61,956,121 (GRCm38) missense possibly damaging 0.82
IGL03387:Ddx60 APN 8 62,012,449 (GRCm38) missense probably damaging 1.00
IGL03411:Ddx60 APN 8 61,977,882 (GRCm38) critical splice acceptor site probably null
Scatter UTSW 8 62,021,314 (GRCm38) missense possibly damaging 0.80
shotgun UTSW 8 62,037,067 (GRCm38) missense probably benign 0.28
splay UTSW 8 62,021,309 (GRCm38) missense possibly damaging 0.80
G1Funyon:Ddx60 UTSW 8 62,000,597 (GRCm38) missense probably benign 0.01
PIT4504001:Ddx60 UTSW 8 61,958,113 (GRCm38) missense probably benign
PIT4677001:Ddx60 UTSW 8 61,972,254 (GRCm38) missense possibly damaging 0.87
R0090:Ddx60 UTSW 8 61,942,293 (GRCm38) missense probably damaging 1.00
R0266:Ddx60 UTSW 8 62,033,493 (GRCm38) missense possibly damaging 0.92
R0325:Ddx60 UTSW 8 61,983,855 (GRCm38) missense probably benign 0.00
R0367:Ddx60 UTSW 8 62,017,749 (GRCm38) missense possibly damaging 0.78
R0403:Ddx60 UTSW 8 61,994,541 (GRCm38) splice site probably benign
R0479:Ddx60 UTSW 8 61,969,657 (GRCm38) missense probably damaging 1.00
R0561:Ddx60 UTSW 8 62,017,794 (GRCm38) missense possibly damaging 0.93
R0844:Ddx60 UTSW 8 61,987,361 (GRCm38) missense probably benign 0.27
R1119:Ddx60 UTSW 8 61,942,544 (GRCm38) missense probably damaging 1.00
R1428:Ddx60 UTSW 8 61,958,159 (GRCm38) splice site probably benign
R1778:Ddx60 UTSW 8 61,974,176 (GRCm38) missense possibly damaging 0.85
R1840:Ddx60 UTSW 8 61,969,553 (GRCm38) missense probably damaging 0.99
R1964:Ddx60 UTSW 8 61,948,869 (GRCm38) missense probably benign 0.10
R1970:Ddx60 UTSW 8 61,972,206 (GRCm38) missense possibly damaging 0.93
R2101:Ddx60 UTSW 8 61,940,645 (GRCm38) missense probably damaging 1.00
R2174:Ddx60 UTSW 8 62,017,200 (GRCm38) missense probably benign 0.01
R2174:Ddx60 UTSW 8 61,956,141 (GRCm38) missense probably damaging 1.00
R2198:Ddx60 UTSW 8 61,958,063 (GRCm38) missense possibly damaging 0.79
R2332:Ddx60 UTSW 8 62,037,091 (GRCm38) missense probably benign 0.08
R2338:Ddx60 UTSW 8 62,012,436 (GRCm38) missense possibly damaging 0.91
R2379:Ddx60 UTSW 8 62,037,088 (GRCm38) missense probably damaging 1.00
R4010:Ddx60 UTSW 8 61,956,144 (GRCm38) missense probably benign 0.25
R4010:Ddx60 UTSW 8 61,954,535 (GRCm38) missense possibly damaging 0.65
R4133:Ddx60 UTSW 8 61,972,220 (GRCm38) missense probably damaging 0.99
R4282:Ddx60 UTSW 8 61,994,393 (GRCm38) missense probably damaging 0.99
R4382:Ddx60 UTSW 8 61,948,978 (GRCm38) splice site probably null
R4561:Ddx60 UTSW 8 61,942,461 (GRCm38) missense probably damaging 0.96
R4572:Ddx60 UTSW 8 61,987,421 (GRCm38) missense probably damaging 1.00
R4581:Ddx60 UTSW 8 62,023,261 (GRCm38) missense possibly damaging 0.90
R4635:Ddx60 UTSW 8 62,037,067 (GRCm38) missense probably benign 0.28
R4698:Ddx60 UTSW 8 62,012,424 (GRCm38) missense probably benign 0.01
R4807:Ddx60 UTSW 8 61,979,338 (GRCm38) missense probably damaging 1.00
R4858:Ddx60 UTSW 8 62,021,314 (GRCm38) missense possibly damaging 0.80
R4964:Ddx60 UTSW 8 61,979,338 (GRCm38) missense probably damaging 1.00
R5120:Ddx60 UTSW 8 61,945,906 (GRCm38) missense probably benign 0.01
R5187:Ddx60 UTSW 8 61,974,188 (GRCm38) missense probably damaging 1.00
R5222:Ddx60 UTSW 8 61,984,158 (GRCm38) missense probably damaging 0.99
R5400:Ddx60 UTSW 8 62,010,002 (GRCm38) missense possibly damaging 0.65
R5500:Ddx60 UTSW 8 61,950,451 (GRCm38) missense probably benign 0.28
R5514:Ddx60 UTSW 8 61,958,057 (GRCm38) missense probably damaging 1.00
R5668:Ddx60 UTSW 8 62,000,578 (GRCm38) missense probably benign 0.38
R5742:Ddx60 UTSW 8 61,948,921 (GRCm38) missense probably benign
R5772:Ddx60 UTSW 8 61,948,897 (GRCm38) missense probably damaging 1.00
R5810:Ddx60 UTSW 8 62,012,388 (GRCm38) nonsense probably null
R5815:Ddx60 UTSW 8 61,963,722 (GRCm38) missense probably damaging 0.98
R5820:Ddx60 UTSW 8 61,956,121 (GRCm38) missense possibly damaging 0.82
R5866:Ddx60 UTSW 8 61,940,740 (GRCm38) missense probably damaging 1.00
R5881:Ddx60 UTSW 8 62,037,070 (GRCm38) missense probably damaging 1.00
R5977:Ddx60 UTSW 8 62,021,410 (GRCm38) critical splice donor site probably null
R6048:Ddx60 UTSW 8 62,000,582 (GRCm38) missense probably benign 0.01
R6061:Ddx60 UTSW 8 62,023,241 (GRCm38) missense probably null 0.01
R6153:Ddx60 UTSW 8 61,945,940 (GRCm38) missense possibly damaging 0.47
R6287:Ddx60 UTSW 8 61,950,578 (GRCm38) missense probably damaging 1.00
R6415:Ddx60 UTSW 8 61,983,905 (GRCm38) missense probably benign 0.00
R6416:Ddx60 UTSW 8 61,998,681 (GRCm38) missense probably benign
R6416:Ddx60 UTSW 8 61,977,950 (GRCm38) missense probably benign 0.00
R6660:Ddx60 UTSW 8 61,956,239 (GRCm38) missense probably benign 0.00
R6694:Ddx60 UTSW 8 62,037,070 (GRCm38) missense probably damaging 1.00
R6715:Ddx60 UTSW 8 61,983,890 (GRCm38) missense probably benign 0.03
R6720:Ddx60 UTSW 8 62,000,689 (GRCm38) missense probably benign 0.10
R6937:Ddx60 UTSW 8 62,037,069 (GRCm38) missense probably damaging 1.00
R7153:Ddx60 UTSW 8 61,988,108 (GRCm38) missense possibly damaging 0.71
R7274:Ddx60 UTSW 8 61,940,108 (GRCm38) critical splice donor site probably null
R7409:Ddx60 UTSW 8 61,958,578 (GRCm38) missense probably benign 0.24
R7464:Ddx60 UTSW 8 61,940,674 (GRCm38) missense possibly damaging 0.82
R7670:Ddx60 UTSW 8 61,975,792 (GRCm38) missense probably damaging 1.00
R7904:Ddx60 UTSW 8 61,977,890 (GRCm38) missense possibly damaging 0.81
R7992:Ddx60 UTSW 8 61,954,535 (GRCm38) missense probably benign 0.03
R8124:Ddx60 UTSW 8 61,983,911 (GRCm38) missense probably benign
R8125:Ddx60 UTSW 8 61,983,911 (GRCm38) missense probably benign
R8126:Ddx60 UTSW 8 61,983,911 (GRCm38) missense probably benign
R8155:Ddx60 UTSW 8 62,017,171 (GRCm38) missense possibly damaging 0.61
R8174:Ddx60 UTSW 8 62,017,250 (GRCm38) splice site probably null
R8271:Ddx60 UTSW 8 61,940,108 (GRCm38) critical splice donor site probably null
R8301:Ddx60 UTSW 8 62,000,597 (GRCm38) missense probably benign 0.01
R8304:Ddx60 UTSW 8 61,998,769 (GRCm38) missense possibly damaging 0.67
R8319:Ddx60 UTSW 8 61,942,635 (GRCm38) critical splice donor site probably null
R8374:Ddx60 UTSW 8 61,974,171 (GRCm38) missense probably benign 0.01
R8401:Ddx60 UTSW 8 61,956,243 (GRCm38) missense possibly damaging 0.57
R8487:Ddx60 UTSW 8 61,974,150 (GRCm38) missense probably damaging 1.00
R8804:Ddx60 UTSW 8 61,958,606 (GRCm38) missense probably benign 0.27
R8826:Ddx60 UTSW 8 61,945,956 (GRCm38) missense probably benign 0.02
R8829:Ddx60 UTSW 8 61,940,661 (GRCm38) missense probably damaging 1.00
R8881:Ddx60 UTSW 8 62,021,309 (GRCm38) missense possibly damaging 0.80
R8884:Ddx60 UTSW 8 61,994,519 (GRCm38) missense possibly damaging 0.86
R8990:Ddx60 UTSW 8 61,974,134 (GRCm38) nonsense probably null
R9122:Ddx60 UTSW 8 61,989,864 (GRCm38) missense probably benign 0.16
R9225:Ddx60 UTSW 8 62,017,841 (GRCm38) missense probably benign 0.36
R9278:Ddx60 UTSW 8 61,977,978 (GRCm38) missense possibly damaging 0.83
R9293:Ddx60 UTSW 8 62,009,960 (GRCm38) missense possibly damaging 0.89
R9405:Ddx60 UTSW 8 61,972,214 (GRCm38) missense probably benign 0.03
R9766:Ddx60 UTSW 8 62,012,278 (GRCm38) missense probably damaging 1.00
X0003:Ddx60 UTSW 8 62,033,417 (GRCm38) missense possibly damaging 0.88
X0019:Ddx60 UTSW 8 61,963,692 (GRCm38) missense probably benign 0.01
Z1177:Ddx60 UTSW 8 62,000,588 (GRCm38) missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GGACATATCTTCTCTCATACTTGGATC -3'
(R):5'- CAGAAAATGACCTTGATTTATCACG -3'

Sequencing Primer
(F):5'- CTGGAATTCACTCTGTAGACCAGG -3'
(R):5'- GACCTTGATTTATCACGTTCTTTAAC -3'
Posted On 2020-07-13