Incidental Mutation 'R8192:Ddx60'
ID635225
Institutional Source Beutler Lab
Gene Symbol Ddx60
Ensembl Gene ENSMUSG00000037921
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 60
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.136) question?
Stock #R8192 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location61928087-62038244 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 61977968 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 846 (T846A)
Ref Sequence ENSEMBL: ENSMUSP00000091197 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070631] [ENSMUST00000093485]
Predicted Effect probably damaging
Transcript: ENSMUST00000070631
AA Change: T845A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000070741
Gene: ENSMUSG00000037921
AA Change: T845A

DomainStartEndE-ValueType
low complexity region 99 110 N/A INTRINSIC
low complexity region 364 376 N/A INTRINSIC
DEXDc 758 949 1.05e-15 SMART
Blast:DEXDc 1007 1132 4e-24 BLAST
HELICc 1245 1328 4.35e-13 SMART
low complexity region 1362 1373 N/A INTRINSIC
Blast:DEXDc 1503 1584 1e-20 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000093485
AA Change: T846A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000091197
Gene: ENSMUSG00000037921
AA Change: T846A

DomainStartEndE-ValueType
low complexity region 99 110 N/A INTRINSIC
low complexity region 364 376 N/A INTRINSIC
DEXDc 759 950 1.05e-15 SMART
Blast:DEXDc 1008 1133 4e-24 BLAST
HELICc 1246 1329 4.35e-13 SMART
low complexity region 1363 1374 N/A INTRINSIC
Blast:DEXDc 1504 1585 1e-20 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 100% (64/64)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal immunity to several viruses (IAV, EMCV, SINV) but increased susceptibility to VSV infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 A T 8: 43,650,933 D558E probably damaging Het
Alox15 T A 11: 70,350,910 E48D probably benign Het
Alyref T C 11: 120,597,696 E102G probably benign Het
Bach2 A G 4: 32,562,294 S254G probably benign Het
BC080695 T G 4: 143,571,960 Y158D probably benign Het
Bcl2l13 A G 6: 120,876,306 E184G possibly damaging Het
Best1 T A 19: 9,986,300 I506F possibly damaging Het
Cd177 T A 7: 24,754,302 D388V probably benign Het
Cep350 T C 1: 155,940,783 K329E possibly damaging Het
Clasrp T C 7: 19,595,462 N65S possibly damaging Het
Cobl T C 11: 12,249,745 R1301G probably benign Het
Cul9 T C 17: 46,538,347 E624G probably benign Het
Cyp21a1 A T 17: 34,803,659 Y109N probably damaging Het
Dbf4 A G 5: 8,398,134 S359P probably benign Het
Dnah11 A G 12: 118,012,446 V2746A probably benign Het
Dnah12 G A 14: 26,706,881 A221T probably benign Het
Dnajb8 C T 6: 88,222,958 R159C possibly damaging Het
Dock2 A G 11: 34,732,339 probably null Het
Dpy19l1 T C 9: 24,450,727 I119V possibly damaging Het
Dsg1c A G 18: 20,266,198 T120A probably damaging Het
Dzank1 T C 2: 144,490,225 H397R probably benign Het
Fam35a A T 14: 34,245,216 S680T probably benign Het
Gaa G T 11: 119,270,409 A93S possibly damaging Het
Galnt4 G A 10: 99,109,256 R281H probably benign Het
Gm13103 G A 4: 143,851,539 W123* probably null Het
Gm3250 T C 10: 77,782,457 E29G unknown Het
Gm5065 T A 7: 5,359,596 D75E possibly damaging Het
H13 T G 2: 152,669,602 D7E probably benign Het
H60c T A 10: 3,259,781 I140F probably benign Het
Hsd3b2 T C 3: 98,713,592 N49S probably benign Het
Klhl11 G T 11: 100,464,096 P300T probably benign Het
Knop1 C A 7: 118,853,146 V117L Het
Lrrc38 G A 4: 143,350,733 G189R probably damaging Het
Lrrc9 A T 12: 72,449,389 I13F probably damaging Het
Macf1 A G 4: 123,440,597 S4456P probably damaging Het
Mkrn1 A T 6: 39,399,355 V439D probably damaging Het
Muc2 T A 7: 141,751,478 V612D Het
Nrxn3 A G 12: 90,204,795 N967D probably benign Het
Olfr1173 A C 2: 88,274,944 V35G probably damaging Het
Olfr978 T A 9: 39,994,171 D120E probably damaging Het
Oprm1 C T 10: 6,838,417 P391S probably benign Het
Parp14 T A 16: 35,871,214 E47V probably benign Het
Pikfyve A G 1: 65,246,395 E931G possibly damaging Het
Plcz1 A T 6: 140,023,260 C151S probably damaging Het
Rbm26 A G 14: 105,142,689 probably null Het
Rffl G T 11: 82,812,723 probably null Het
Sc5d T C 9: 42,259,798 I32V probably benign Het
Scube1 A G 15: 83,629,382 probably null Het
Slc12a6 A G 2: 112,351,377 Y714C probably damaging Het
Slc26a3 A G 12: 31,468,542 I670V probably benign Het
Slc8a3 A T 12: 81,199,681 V866D probably damaging Het
Slco3a1 A T 7: 74,320,590 M423K probably benign Het
Smc6 A G 12: 11,299,335 E773G probably benign Het
Son A G 16: 91,655,549 T395A possibly damaging Het
Ss18l1 T C 2: 180,059,362 S290P probably damaging Het
Tcof1 A C 18: 60,843,303 V78G probably damaging Het
Thsd1 G A 8: 22,243,902 V322M probably benign Het
Tln2 A T 9: 67,346,529 C753* probably null Het
Trav6n-6 T A 14: 53,133,040 F83I probably damaging Het
Ttc39d A G 17: 80,216,578 H222R probably damaging Het
Ugt2b35 T A 5: 87,001,443 S184R probably damaging Het
Upf1 A G 8: 70,340,644 L288P probably benign Het
Zfp442 T C 2: 150,408,709 I424M unknown Het
Zfp580 T C 7: 5,053,115 V100A probably benign Het
Zfpm1 C A 8: 122,332,094 P151Q probably damaging Het
Zfr2 C T 10: 81,242,815 P294S possibly damaging Het
Other mutations in Ddx60
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Ddx60 APN 8 61958646 missense probably damaging 1.00
IGL00915:Ddx60 APN 8 61987431 missense possibly damaging 0.79
IGL00931:Ddx60 APN 8 61969583 missense probably benign 0.18
IGL01023:Ddx60 APN 8 61942514 missense probably damaging 0.99
IGL01313:Ddx60 APN 8 61982526 missense probably damaging 1.00
IGL01615:Ddx60 APN 8 61963740 missense probably null 0.81
IGL01733:Ddx60 APN 8 61983865 missense probably damaging 0.99
IGL01779:Ddx60 APN 8 62017823 missense possibly damaging 0.94
IGL01900:Ddx60 APN 8 62000709 splice site probably benign
IGL02110:Ddx60 APN 8 62017247 critical splice donor site probably null
IGL02302:Ddx60 APN 8 61975832 missense possibly damaging 0.85
IGL02468:Ddx60 APN 8 61958642 missense probably damaging 1.00
IGL02569:Ddx60 APN 8 62024951 missense possibly damaging 0.93
IGL02622:Ddx60 APN 8 61942436 splice site probably null
IGL02657:Ddx60 APN 8 61984115 missense probably benign 0.01
IGL02677:Ddx60 APN 8 61988132 missense probably damaging 1.00
IGL02701:Ddx60 APN 8 61979341 missense probably damaging 0.96
IGL02806:Ddx60 APN 8 61956122 missense probably benign 0.00
IGL03137:Ddx60 APN 8 61988083 missense possibly damaging 0.61
IGL03295:Ddx60 APN 8 61956121 missense possibly damaging 0.82
IGL03387:Ddx60 APN 8 62012449 missense probably damaging 1.00
IGL03411:Ddx60 APN 8 61977882 critical splice acceptor site probably null
PIT4504001:Ddx60 UTSW 8 61958113 missense probably benign
PIT4677001:Ddx60 UTSW 8 61972254 missense possibly damaging 0.87
R0090:Ddx60 UTSW 8 61942293 missense probably damaging 1.00
R0266:Ddx60 UTSW 8 62033493 missense possibly damaging 0.92
R0325:Ddx60 UTSW 8 61983855 missense probably benign 0.00
R0367:Ddx60 UTSW 8 62017749 missense possibly damaging 0.78
R0403:Ddx60 UTSW 8 61994541 splice site probably benign
R0479:Ddx60 UTSW 8 61969657 missense probably damaging 1.00
R0561:Ddx60 UTSW 8 62017794 missense possibly damaging 0.93
R0844:Ddx60 UTSW 8 61987361 missense probably benign 0.27
R1119:Ddx60 UTSW 8 61942544 missense probably damaging 1.00
R1428:Ddx60 UTSW 8 61958159 splice site probably benign
R1778:Ddx60 UTSW 8 61974176 missense possibly damaging 0.85
R1840:Ddx60 UTSW 8 61969553 missense probably damaging 0.99
R1964:Ddx60 UTSW 8 61948869 missense probably benign 0.10
R1970:Ddx60 UTSW 8 61972206 missense possibly damaging 0.93
R2101:Ddx60 UTSW 8 61940645 missense probably damaging 1.00
R2174:Ddx60 UTSW 8 61956141 missense probably damaging 1.00
R2174:Ddx60 UTSW 8 62017200 missense probably benign 0.01
R2198:Ddx60 UTSW 8 61958063 missense possibly damaging 0.79
R2332:Ddx60 UTSW 8 62037091 missense probably benign 0.08
R2338:Ddx60 UTSW 8 62012436 missense possibly damaging 0.91
R2379:Ddx60 UTSW 8 62037088 missense probably damaging 1.00
R4010:Ddx60 UTSW 8 61954535 missense possibly damaging 0.65
R4010:Ddx60 UTSW 8 61956144 missense probably benign 0.25
R4133:Ddx60 UTSW 8 61972220 missense probably damaging 0.99
R4282:Ddx60 UTSW 8 61994393 missense probably damaging 0.99
R4382:Ddx60 UTSW 8 61948978 splice site probably null
R4561:Ddx60 UTSW 8 61942461 missense probably damaging 0.96
R4572:Ddx60 UTSW 8 61987421 missense probably damaging 1.00
R4581:Ddx60 UTSW 8 62023261 missense possibly damaging 0.90
R4635:Ddx60 UTSW 8 62037067 missense probably benign 0.28
R4698:Ddx60 UTSW 8 62012424 missense probably benign 0.01
R4807:Ddx60 UTSW 8 61979338 missense probably damaging 1.00
R4858:Ddx60 UTSW 8 62021314 missense possibly damaging 0.80
R4964:Ddx60 UTSW 8 61979338 missense probably damaging 1.00
R5120:Ddx60 UTSW 8 61945906 missense probably benign 0.01
R5187:Ddx60 UTSW 8 61974188 missense probably damaging 1.00
R5222:Ddx60 UTSW 8 61984158 missense probably damaging 0.99
R5400:Ddx60 UTSW 8 62010002 missense possibly damaging 0.65
R5500:Ddx60 UTSW 8 61950451 missense probably benign 0.28
R5514:Ddx60 UTSW 8 61958057 missense probably damaging 1.00
R5668:Ddx60 UTSW 8 62000578 missense probably benign 0.38
R5742:Ddx60 UTSW 8 61948921 missense probably benign
R5772:Ddx60 UTSW 8 61948897 missense probably damaging 1.00
R5810:Ddx60 UTSW 8 62012388 nonsense probably null
R5815:Ddx60 UTSW 8 61963722 missense probably damaging 0.98
R5820:Ddx60 UTSW 8 61956121 missense possibly damaging 0.82
R5866:Ddx60 UTSW 8 61940740 missense probably damaging 1.00
R5881:Ddx60 UTSW 8 62037070 missense probably damaging 1.00
R5977:Ddx60 UTSW 8 62021410 critical splice donor site probably null
R6048:Ddx60 UTSW 8 62000582 missense probably benign 0.01
R6061:Ddx60 UTSW 8 62023241 missense probably null 0.01
R6153:Ddx60 UTSW 8 61945940 missense possibly damaging 0.47
R6287:Ddx60 UTSW 8 61950578 missense probably damaging 1.00
R6415:Ddx60 UTSW 8 61983905 missense probably benign 0.00
R6416:Ddx60 UTSW 8 61977950 missense probably benign 0.00
R6416:Ddx60 UTSW 8 61998681 missense probably benign
R6660:Ddx60 UTSW 8 61956239 missense probably benign 0.00
R6694:Ddx60 UTSW 8 62037070 missense probably damaging 1.00
R6715:Ddx60 UTSW 8 61983890 missense probably benign 0.03
R6720:Ddx60 UTSW 8 62000689 missense probably benign 0.10
R6937:Ddx60 UTSW 8 62037069 missense probably damaging 1.00
R7153:Ddx60 UTSW 8 61988108 missense possibly damaging 0.71
R7274:Ddx60 UTSW 8 61940108 critical splice donor site probably null
R7409:Ddx60 UTSW 8 61958578 missense probably benign 0.24
R7464:Ddx60 UTSW 8 61940674 missense possibly damaging 0.82
R7670:Ddx60 UTSW 8 61975792 missense probably damaging 1.00
R7904:Ddx60 UTSW 8 61977890 missense possibly damaging 0.81
R7992:Ddx60 UTSW 8 61954535 missense probably benign 0.03
R8124:Ddx60 UTSW 8 61983911 missense probably benign
R8125:Ddx60 UTSW 8 61983911 missense probably benign
R8126:Ddx60 UTSW 8 61983911 missense probably benign
R8155:Ddx60 UTSW 8 62017171 missense possibly damaging 0.61
R8174:Ddx60 UTSW 8 62017250 splice site probably null
R8271:Ddx60 UTSW 8 61940108 critical splice donor site probably null
R8301:Ddx60 UTSW 8 62000597 missense probably benign 0.01
R8304:Ddx60 UTSW 8 61998769 missense possibly damaging 0.67
R8319:Ddx60 UTSW 8 61942635 critical splice donor site probably null
R8374:Ddx60 UTSW 8 61974171 missense probably benign 0.01
R8401:Ddx60 UTSW 8 61956243 missense possibly damaging 0.57
X0003:Ddx60 UTSW 8 62033417 missense possibly damaging 0.88
X0019:Ddx60 UTSW 8 61963692 missense probably benign 0.01
Z1177:Ddx60 UTSW 8 62000588 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GGACATATCTTCTCTCATACTTGGATC -3'
(R):5'- CAGAAAATGACCTTGATTTATCACG -3'

Sequencing Primer
(F):5'- CTGGAATTCACTCTGTAGACCAGG -3'
(R):5'- GACCTTGATTTATCACGTTCTTTAAC -3'
Posted On2020-07-13