Mutagenetix > Incidental Mutation

Incidental Mutation 'R8192:Lrrc9'

635246

Institutional Source

Beutler Lab

Gene Symbol

Lrrc9

Ensembl Gene

ENSMUSG00000021090

Gene Name

leucine rich repeat containing 9

Synonyms

4930432K16Rik, 4921529O18Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.236) question?

Stock #

R8192 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

72441866-72530750 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 72449389 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 13 (I13F)

Ref Sequence

ENSEMBL: ENSMUSP00000124394 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000161284] [ENSMUST00000162159] [ENSMUST00000221360]

AlphaFold

Q8CDN9

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160394

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161195

Predicted Effect

possibly damaging
Transcript: ENSMUST00000161284
AA Change: I13F

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000124602
Gene: ENSMUSG00000021090
AA Change: I13F

Domain	Start	End	E-Value	Type
Pfam:LRR_4	77	118	2.8e-11	PFAM
LRR	119	140	8.49e1	SMART
LRR	141	164	2.27e1	SMART
LRR	165	187	2.09e2	SMART
LRRcap	210	228	6.12e1	SMART
low complexity region	373	384	N/A	INTRINSIC
low complexity region	424	436	N/A	INTRINSIC
LRR	706	727	1.41e2	SMART
LRR	728	749	6.78e1	SMART
LRR	750	773	7.17e1	SMART
LRRcap	793	811	2.26e2	SMART
LRR	943	966	2.67e-1	SMART
LRR	967	992	1.22e1	SMART
LRRcap	1031	1049	4.37e0	SMART
low complexity region	1109	1120	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161957

Predicted Effect

probably damaging
Transcript: ENSMUST00000162159
AA Change: I13F

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000124394
Gene: ENSMUSG00000021090
AA Change: I13F

Domain	Start	End	E-Value	Type
LRR	53	74	5.39e2	SMART
LRR	75	96	1.14e2	SMART
LRR	97	118	7.9e-4	SMART
LRR	119	140	2.75e-3	SMART
LRR	141	164	2.27e1	SMART
LRR	164	185	1.87e1	SMART
LRRcap	210	228	6.12e1	SMART
low complexity region	373	384	N/A	INTRINSIC
low complexity region	424	436	N/A	INTRINSIC
LRR	705	726	1.41e2	SMART
LRR	727	748	6.78e1	SMART
LRR	749	771	1.37e1	SMART
LRRcap	792	810	2.26e2	SMART
LRR	898	919	2.62e1	SMART
LRR	920	941	5.17e1	SMART
LRR	942	965	2.67e-1	SMART
LRR	966	991	1.22e1	SMART
LRR	1013	1032	4.42e2	SMART
LRRcap	1030	1048	4.37e0	SMART
low complexity region	1108	1119	N/A	INTRINSIC
LRR	1128	1150	2.4e1	SMART
LRR	1191	1209	5.7e2	SMART
LRR	1215	1236	1.03e-2	SMART
LRR	1237	1260	8.48e0	SMART
LRR	1283	1304	2.67e-1	SMART
Blast:LRR	1308	1333	4e-6	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162179

Predicted Effect

probably damaging
Transcript: ENSMUST00000221360
AA Change: I13F

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.0%

Validation Efficiency

100% (64/64)

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam34	A	T	8: 43,650,933	D558E	probably damaging	Het
Alox15	T	A	11: 70,350,910	E48D	probably benign	Het
Alyref	T	C	11: 120,597,696	E102G	probably benign	Het
Bach2	A	G	4: 32,562,294	S254G	probably benign	Het
BC080695	T	G	4: 143,571,960	Y158D	probably benign	Het
Bcl2l13	A	G	6: 120,876,306	E184G	possibly damaging	Het
Best1	T	A	19: 9,986,300	I506F	possibly damaging	Het
Cd177	T	A	7: 24,754,302	D388V	probably benign	Het
Cep350	T	C	1: 155,940,783	K329E	possibly damaging	Het
Clasrp	T	C	7: 19,595,462	N65S	possibly damaging	Het
Cobl	T	C	11: 12,249,745	R1301G	probably benign	Het
Cul9	T	C	17: 46,538,347	E624G	probably benign	Het
Cyp21a1	A	T	17: 34,803,659	Y109N	probably damaging	Het
Dbf4	A	G	5: 8,398,134	S359P	probably benign	Het
Ddx60	A	G	8: 61,977,968	T846A	probably damaging	Het
Dnah11	A	G	12: 118,012,446	V2746A	probably benign	Het
Dnah12	G	A	14: 26,706,881	A221T	probably benign	Het
Dnajb8	C	T	6: 88,222,958	R159C	possibly damaging	Het
Dock2	A	G	11: 34,732,339		probably null	Het
Dpy19l1	T	C	9: 24,450,727	I119V	possibly damaging	Het
Dsg1c	A	G	18: 20,266,198	T120A	probably damaging	Het
Dzank1	T	C	2: 144,490,225	H397R	probably benign	Het
Fam35a	A	T	14: 34,245,216	S680T	probably benign	Het
Gaa	G	T	11: 119,270,409	A93S	possibly damaging	Het
Galnt4	G	A	10: 99,109,256	R281H	probably benign	Het
Gm13103	G	A	4: 143,851,539	W123*	probably null	Het
Gm3250	T	C	10: 77,782,457	E29G	unknown	Het
Gm5065	T	A	7: 5,359,596	D75E	possibly damaging	Het
H13	T	G	2: 152,669,602	D7E	probably benign	Het
H60c	T	A	10: 3,259,781	I140F	probably benign	Het
Hsd3b2	T	C	3: 98,713,592	N49S	probably benign	Het
Klhl11	G	T	11: 100,464,096	P300T	probably benign	Het
Knop1	C	A	7: 118,853,146	V117L		Het
Lrrc38	G	A	4: 143,350,733	G189R	probably damaging	Het
Macf1	A	G	4: 123,440,597	S4456P	probably damaging	Het
Mkrn1	A	T	6: 39,399,355	V439D	probably damaging	Het
Muc2	T	A	7: 141,751,478	V612D		Het
Nrxn3	A	G	12: 90,204,795	N967D	probably benign	Het
Olfr1173	A	C	2: 88,274,944	V35G	probably damaging	Het
Olfr978	T	A	9: 39,994,171	D120E	probably damaging	Het
Oprm1	C	T	10: 6,838,417	P391S	probably benign	Het
Parp14	T	A	16: 35,871,214	E47V	probably benign	Het
Pikfyve	A	G	1: 65,246,395	E931G	possibly damaging	Het
Plcz1	A	T	6: 140,023,260	C151S	probably damaging	Het
Rbm26	A	G	14: 105,142,689		probably null	Het
Rffl	G	T	11: 82,812,723		probably null	Het
Sc5d	T	C	9: 42,259,798	I32V	probably benign	Het
Scube1	A	G	15: 83,629,382		probably null	Het
Slc12a6	A	G	2: 112,351,377	Y714C	probably damaging	Het
Slc26a3	A	G	12: 31,468,542	I670V	probably benign	Het
Slc8a3	A	T	12: 81,199,681	V866D	probably damaging	Het
Slco3a1	A	T	7: 74,320,590	M423K	probably benign	Het
Smc6	A	G	12: 11,299,335	E773G	probably benign	Het
Son	A	G	16: 91,655,549	T395A	possibly damaging	Het
Ss18l1	T	C	2: 180,059,362	S290P	probably damaging	Het
Tcof1	A	C	18: 60,843,303	V78G	probably damaging	Het
Thsd1	G	A	8: 22,243,902	V322M	probably benign	Het
Tln2	A	T	9: 67,346,529	C753*	probably null	Het
Trav6n-6	T	A	14: 53,133,040	F83I	probably damaging	Het
Ttc39d	A	G	17: 80,216,578	H222R	probably damaging	Het
Ugt2b35	T	A	5: 87,001,443	S184R	probably damaging	Het
Upf1	A	G	8: 70,340,644	L288P	probably benign	Het
Zfp442	T	C	2: 150,408,709	I424M	unknown	Het
Zfp580	T	C	7: 5,053,115	V100A	probably benign	Het
Zfpm1	C	A	8: 122,332,094	P151Q	probably damaging	Het
Zfr2	C	T	10: 81,242,815	P294S	possibly damaging	Het

Other mutations in Lrrc9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Lrrc9	APN	12	72486243	missense	possibly damaging	0.63
IGL00843:Lrrc9	APN	12	72463417	missense	possibly damaging	0.78
IGL01923:Lrrc9	APN	12	72510412	missense	possibly damaging	0.93
IGL02027:Lrrc9	APN	12	72470334	splice site	probably benign
IGL02271:Lrrc9	APN	12	72510381	missense	probably benign	0.06
IGL02398:Lrrc9	APN	12	72466903	missense	probably benign
IGL02795:Lrrc9	APN	12	72478768	missense	probably damaging	1.00
IGL02931:Lrrc9	APN	12	72454149	missense	probably damaging	1.00
IGL03257:Lrrc9	APN	12	72449768	missense	probably benign
BB006:Lrrc9	UTSW	12	72486297	missense	possibly damaging	0.92
BB016:Lrrc9	UTSW	12	72486297	missense	possibly damaging	0.92
IGL02799:Lrrc9	UTSW	12	72506404	missense	probably damaging	1.00
R0172:Lrrc9	UTSW	12	72463486	missense	possibly damaging	0.50
R0315:Lrrc9	UTSW	12	72456028	missense	probably damaging	0.96
R0492:Lrrc9	UTSW	12	72478763	missense	possibly damaging	0.47
R0617:Lrrc9	UTSW	12	72483014	missense	probably damaging	1.00
R0639:Lrrc9	UTSW	12	72486288	missense	probably damaging	1.00
R0987:Lrrc9	UTSW	12	72510382	missense	probably benign	0.00
R1325:Lrrc9	UTSW	12	72497104	missense	probably damaging	0.99
R1465:Lrrc9	UTSW	12	72500759	missense	probably benign	0.05
R1465:Lrrc9	UTSW	12	72500759	missense	probably benign	0.05
R1479:Lrrc9	UTSW	12	72460825	nonsense	probably null
R1564:Lrrc9	UTSW	12	72487053	missense	probably damaging	1.00
R1626:Lrrc9	UTSW	12	72495661	splice site	probably null
R1632:Lrrc9	UTSW	12	72460020	splice site	probably null
R1715:Lrrc9	UTSW	12	72477299	missense	probably damaging	1.00
R1743:Lrrc9	UTSW	12	72456117	missense	probably damaging	1.00
R1779:Lrrc9	UTSW	12	72455998	nonsense	probably null
R1866:Lrrc9	UTSW	12	72497138	missense	probably damaging	0.97
R1878:Lrrc9	UTSW	12	72476164	critical splice donor site	probably null
R1990:Lrrc9	UTSW	12	72497861	missense	probably damaging	0.99
R2361:Lrrc9	UTSW	12	72463470	missense	possibly damaging	0.52
R3752:Lrrc9	UTSW	12	72460806	nonsense	probably null
R3833:Lrrc9	UTSW	12	72482991	missense	probably damaging	1.00
R4134:Lrrc9	UTSW	12	72466966	missense	probably benign	0.00
R4651:Lrrc9	UTSW	12	72477386	missense	probably damaging	1.00
R4652:Lrrc9	UTSW	12	72477386	missense	probably damaging	1.00
R4659:Lrrc9	UTSW	12	72470264	missense	probably damaging	1.00
R4831:Lrrc9	UTSW	12	72499679	missense	probably damaging	1.00
R4857:Lrrc9	UTSW	12	72499692	missense	possibly damaging	0.94
R5017:Lrrc9	UTSW	12	72506325	missense	possibly damaging	0.86
R5163:Lrrc9	UTSW	12	72449389	missense	probably damaging	1.00
R5279:Lrrc9	UTSW	12	72495594	missense	possibly damaging	0.80
R5434:Lrrc9	UTSW	12	72454088	missense	probably damaging	0.98
R5783:Lrrc9	UTSW	12	72456053	missense	possibly damaging	0.62
R6021:Lrrc9	UTSW	12	72469231	missense	probably damaging	0.97
R6214:Lrrc9	UTSW	12	72459853	missense	probably damaging	1.00
R6255:Lrrc9	UTSW	12	72487023	missense	probably benign	0.33
R6538:Lrrc9	UTSW	12	72500929	missense	probably benign	0.08
R6563:Lrrc9	UTSW	12	72486395	splice site	probably null
R6672:Lrrc9	UTSW	12	72473936	missense	possibly damaging	0.88
R6919:Lrrc9	UTSW	12	72506393	missense	probably benign	0.01
R6929:Lrrc9	UTSW	12	72450772	missense	probably benign	0.41
R7092:Lrrc9	UTSW	12	72463464	missense	possibly damaging	0.81
R7150:Lrrc9	UTSW	12	72466952	missense	probably benign	0.00
R7338:Lrrc9	UTSW	12	72463531	splice site	probably null
R7398:Lrrc9	UTSW	12	72500816	missense	probably damaging	0.98
R7477:Lrrc9	UTSW	12	72503527	critical splice donor site	probably null
R7501:Lrrc9	UTSW	12	72449716	missense	probably damaging	1.00
R7542:Lrrc9	UTSW	12	72506320	missense	probably damaging	0.96
R7816:Lrrc9	UTSW	12	72495692	missense	probably damaging	1.00
R7870:Lrrc9	UTSW	12	72486190	missense	probably damaging	0.99
R7929:Lrrc9	UTSW	12	72486297	missense	possibly damaging	0.92
R8042:Lrrc9	UTSW	12	72460906	missense	probably benign	0.02
R8108:Lrrc9	UTSW	12	72454059	missense	probably damaging	1.00
R8244:Lrrc9	UTSW	12	72499610	missense	probably benign	0.22
R8333:Lrrc9	UTSW	12	72481543	missense	probably benign	0.38
R9288:Lrrc9	UTSW	12	72476084	missense	probably benign	0.01
R9324:Lrrc9	UTSW	12	72449397	missense	probably damaging	1.00
R9342:Lrrc9	UTSW	12	72459993	missense	probably damaging	1.00
R9557:Lrrc9	UTSW	12	72486207	missense	probably benign	0.01
R9624:Lrrc9	UTSW	12	72450812	missense	probably benign	0.19
R9677:Lrrc9	UTSW	12	72450765	missense	probably damaging	1.00
X0025:Lrrc9	UTSW	12	72497060	missense	probably damaging	1.00
Z1176:Lrrc9	UTSW	12	72477393	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AATCAGGGGCCTGTCAATG -3'
(R):5'- CCATTGCACAGACACTGTTTG -3'

Sequencing Primer
(F):5'- GCCACTGTTGCTAGCACGTTAAG -3'
(R):5'- CCATTGCACAGACACTGTTTGAAAAG -3'

Posted On

2020-07-13